\
| Variant ID: vg0909083757 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9083757 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACATTCTACTTTGGCAGAGGTTACGAGCACAATACCGTTGAATGTTTCATTCCGACGATCAATTGTAGGACCAAAGTTAGTTGAGTGGAATGATTTGAT[T/C]
TCTCGACTAGCTAACATAACCCTGTCAAATGAAAAGGTTTGCTTTGTTTGGTCGCTACATAAAAATGGCTATTTTTCGGTCAAATCCATGTTTAATGCGA
TCGCATTAAACATGGATTTGACCGAAAAATAGCCATTTTTATGTAGCGACCAAACAAAGCAAACCTTTTCATTTGACAGGGTTATGTTAGCTAGTCGAGA[A/G]
ATCAAATCATTCCACTCAACTAACTTTGGTCCTACAATTGATCGTCGGAATGAAACATTCAACGGTATTGTGCTCGTAACCTCTGCCAAAGTAGAATGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 1.10% | 4.82% | 45.75% | NA |
| All Indica | 2759 | 20.00% | 2.00% | 8.16% | 69.84% | NA |
| All Japonica | 1512 | 88.80% | 0.00% | 0.07% | 11.11% | NA |
| Aus | 269 | 81.80% | 0.00% | 0.00% | 18.22% | NA |
| Indica I | 595 | 12.30% | 1.80% | 7.90% | 77.98% | NA |
| Indica II | 465 | 14.40% | 0.60% | 6.67% | 78.28% | NA |
| Indica III | 913 | 26.40% | 2.50% | 8.65% | 62.43% | NA |
| Indica Intermediate | 786 | 21.90% | 2.20% | 8.65% | 67.30% | NA |
| Temperate Japonica | 767 | 88.10% | 0.00% | 0.00% | 11.86% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.20% | 2.78% | NA |
| Japonica Intermediate | 241 | 73.90% | 0.00% | 0.00% | 26.14% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 2.22% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909083757 | T -> DEL | N | N | silent_mutation | Average:9.108; most accessible tissue: Callus, score: 36.407 | N | N | N | N |
| vg0909083757 | T -> C | LOC_Os09g15044.1 | downstream_gene_variant ; 3705.0bp to feature; MODIFIER | silent_mutation | Average:9.108; most accessible tissue: Callus, score: 36.407 | N | N | N | N |
| vg0909083757 | T -> C | LOC_Os09g15040-LOC_Os09g15044 | intergenic_region ; MODIFIER | silent_mutation | Average:9.108; most accessible tissue: Callus, score: 36.407 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909083757 | 2.19E-07 | 1.06E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909083757 | 4.98E-06 | 4.28E-12 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909083757 | NA | 7.62E-06 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909083757 | 1.35E-10 | 2.95E-26 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909083757 | 1.01E-07 | 2.71E-18 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |