\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909083757:

Variant ID: vg0909083757 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9083757
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACATTCTACTTTGGCAGAGGTTACGAGCACAATACCGTTGAATGTTTCATTCCGACGATCAATTGTAGGACCAAAGTTAGTTGAGTGGAATGATTTGAT[T/C]
TCTCGACTAGCTAACATAACCCTGTCAAATGAAAAGGTTTGCTTTGTTTGGTCGCTACATAAAAATGGCTATTTTTCGGTCAAATCCATGTTTAATGCGA

Reverse complement sequence

TCGCATTAAACATGGATTTGACCGAAAAATAGCCATTTTTATGTAGCGACCAAACAAAGCAAACCTTTTCATTTGACAGGGTTATGTTAGCTAGTCGAGA[A/G]
ATCAAATCATTCCACTCAACTAACTTTGGTCCTACAATTGATCGTCGGAATGAAACATTCAACGGTATTGTGCTCGTAACCTCTGCCAAAGTAGAATGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 1.10% 4.82% 45.75% NA
All Indica  2759 20.00% 2.00% 8.16% 69.84% NA
All Japonica  1512 88.80% 0.00% 0.07% 11.11% NA
Aus  269 81.80% 0.00% 0.00% 18.22% NA
Indica I  595 12.30% 1.80% 7.90% 77.98% NA
Indica II  465 14.40% 0.60% 6.67% 78.28% NA
Indica III  913 26.40% 2.50% 8.65% 62.43% NA
Indica Intermediate  786 21.90% 2.20% 8.65% 67.30% NA
Temperate Japonica  767 88.10% 0.00% 0.00% 11.86% NA
Tropical Japonica  504 97.00% 0.00% 0.20% 2.78% NA
Japonica Intermediate  241 73.90% 0.00% 0.00% 26.14% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 81.10% 0.00% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909083757 T -> DEL N N silent_mutation Average:9.108; most accessible tissue: Callus, score: 36.407 N N N N
vg0909083757 T -> C LOC_Os09g15044.1 downstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:9.108; most accessible tissue: Callus, score: 36.407 N N N N
vg0909083757 T -> C LOC_Os09g15040-LOC_Os09g15044 intergenic_region ; MODIFIER silent_mutation Average:9.108; most accessible tissue: Callus, score: 36.407 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909083757 2.19E-07 1.06E-14 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757 4.98E-06 4.28E-12 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757 NA 7.62E-06 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757 1.35E-10 2.95E-26 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757 1.01E-07 2.71E-18 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251