RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0909083757:

Variant ID: vg0909083757 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9083757
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACATTCTACTTTGGCAGAGGTTACGAGCACAATACCGTTGAATGTTTCATTCCGACGATCAATTGTAGGACCAAAGTTAGTTGAGTGGAATGATTTGAT[T/C]
TCTCGACTAGCTAACATAACCCTGTCAAATGAAAAGGTTTGCTTTGTTTGGTCGCTACATAAAAATGGCTATTTTTCGGTCAAATCCATGTTTAATGCGA

Reverse complement sequence

TCGCATTAAACATGGATTTGACCGAAAAATAGCCATTTTTATGTAGCGACCAAACAAAGCAAACCTTTTCATTTGACAGGGTTATGTTAGCTAGTCGAGA[A/G]
ATCAAATCATTCCACTCAACTAACTTTGGTCCTACAATTGATCGTCGGAATGAAACATTCAACGGTATTGTGCTCGTAACCTCTGCCAAAGTAGAATGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	1.10%	4.82%	45.75%	NA
All Indica	2759	20.00%	2.00%	8.16%	69.84%	NA
All Japonica	1512	88.80%	0.00%	0.07%	11.11%	NA
Aus	269	81.80%	0.00%	0.00%	18.22%	NA
Indica I	595	12.30%	1.80%	7.90%	77.98%	NA
Indica II	465	14.40%	0.60%	6.67%	78.28%	NA
Indica III	913	26.40%	2.50%	8.65%	62.43%	NA
Indica Intermediate	786	21.90%	2.20%	8.65%	67.30%	NA
Temperate Japonica	767	88.10%	0.00%	0.00%	11.86%	NA
Tropical Japonica	504	97.00%	0.00%	0.20%	2.78%	NA
Japonica Intermediate	241	73.90%	0.00%	0.00%	26.14%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	81.10%	0.00%	2.22%	16.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909083757	T -> DEL	N	N	silent_mutation	Average:9.108; most accessible tissue: Callus, score: 36.407	N	N	N	N
vg0909083757	T -> C	LOC_Os09g15044.1	downstream_gene_variant ; 3705.0bp to feature; MODIFIER	silent_mutation	Average:9.108; most accessible tissue: Callus, score: 36.407	N	N	N	N
vg0909083757	T -> C	LOC_Os09g15040-LOC_Os09g15044	intergenic_region ; MODIFIER	silent_mutation	Average:9.108; most accessible tissue: Callus, score: 36.407	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909083757	2.19E-07	1.06E-14	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757	4.98E-06	4.28E-12	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757	NA	7.62E-06	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757	1.35E-10	2.95E-26	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909083757	1.01E-07	2.71E-18	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0909083757:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact