\
| Variant ID: vg0909065986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9065986 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 227. )
GTATGTTCTACCGCTGCTAGACTACAAGACAAGATTCTCGCTGTGGCAAGTCAAGATGCGGGCTGTTCTGGCGCAAACTTCGGATCTTGATGAGGCGCTG[A/G]
AAAGCTTCGGGAAGAAGAAATCGACTGAATGGACCGCTGAGGAGAAGCGGAAAGATCGTAAGGCTCTGTCACTGATCCAACTTCATCTATCTAATGATAT
ATATCATTAGATAGATGAAGTTGGATCAGTGACAGAGCCTTACGATCTTTCCGCTTCTCCTCAGCGGTCCATTCAGTCGATTTCTTCTTCCCGAAGCTTT[T/C]
CAGCGCCTCATCAAGATCCGAAGTTTGCGCCAGAACAGCCCGCATCTTGACTTGCCACAGCGAGAATCTTGTCTTGTAGTCTAGCAGCGGTAGAACATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 34.70% | 10.66% | 3.89% | NA |
| All Indica | 2759 | 67.10% | 9.50% | 16.85% | 6.56% | NA |
| All Japonica | 1512 | 14.10% | 85.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 89.20% | 3.70% | 7.06% | 0.00% | NA |
| Indica I | 595 | 74.30% | 6.40% | 16.47% | 2.86% | NA |
| Indica II | 465 | 68.60% | 5.40% | 22.80% | 3.23% | NA |
| Indica III | 913 | 59.70% | 14.30% | 13.69% | 12.27% | NA |
| Indica Intermediate | 786 | 69.30% | 8.70% | 17.30% | 4.71% | NA |
| Temperate Japonica | 767 | 13.40% | 86.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.90% | 70.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 21.90% | 14.58% | 1.04% | NA |
| Intermediate | 90 | 37.80% | 56.70% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909065986 | A -> G | LOC_Os09g15030.1 | missense_variant ; p.Lys39Glu; MODERATE | nonsynonymous_codon ; K39E | Average:19.705; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | unknown | unknown | TOLERATED | 1.00 |
| vg0909065986 | A -> DEL | LOC_Os09g15030.1 | N | frameshift_variant | Average:19.705; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909065986 | NA | 9.80E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 5.25E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 6.21E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 6.77E-09 | mr1727_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 1.34E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 5.10E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909065986 | NA | 5.85E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |