\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909042994:

Variant ID: vg0909042994 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9042994
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGAAAATGTAACGGTAGGGGCATGGAAGGGATCAAATTGAAATTTCAGGGGTATAGAAGGGATCAGATAAATTTCAGGGGTATGAAAGAGATTGAGT[G/A]
AGCTTTCAGGGGTACACAGGAAATTTACTCTTTTCCTAAATCTCGAAGATGATATAAAGTTTGGGAGATGCAGTGATGGTGATTATACGGTTAGTCGTGA

Reverse complement sequence

TCACGACTAACCGTATAATCACCATCACTGCATCTCCCAAACTTTATATCATCTTCGAGATTTAGGAAAAGAGTAAATTTCCTGTGTACCCCTGAAAGCT[C/T]
ACTCAATCTCTTTCATACCCCTGAAATTTATCTGATCCCTTCTATACCCCTGAAATTTCAATTTGATCCCTTCCATGCCCCTACCGTTACATTTTCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 2.10% 8.06% 55.01% NA
All Indica  2759 9.30% 1.40% 6.34% 82.93% NA
All Japonica  1512 85.90% 3.70% 0.79% 9.59% NA
Aus  269 4.50% 0.70% 55.02% 39.78% NA
Indica I  595 6.10% 1.30% 3.87% 88.74% NA
Indica II  465 5.20% 0.60% 10.97% 83.23% NA
Indica III  913 15.00% 1.50% 3.72% 79.74% NA
Indica Intermediate  786 7.60% 1.80% 8.52% 82.06% NA
Temperate Japonica  767 87.00% 6.90% 0.13% 6.00% NA
Tropical Japonica  504 92.30% 0.00% 0.60% 7.14% NA
Japonica Intermediate  241 69.30% 1.20% 3.32% 26.14% NA
VI/Aromatic  96 22.90% 3.10% 34.38% 39.58% NA
Intermediate  90 61.10% 0.00% 14.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909042994 G -> DEL N N silent_mutation Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg0909042994 G -> A LOC_Os09g15010.1 upstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg0909042994 G -> A LOC_Os09g15010-LOC_Os09g15020 intergenic_region ; MODIFIER silent_mutation Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909042994 2.00E-06 5.51E-06 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 6.75E-06 NA mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 6.89E-06 NA mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 9.14E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 2.69E-07 3.52E-07 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 4.34E-06 5.86E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 5.51E-07 3.82E-06 mr1619 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 5.39E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 3.92E-24 mr1888 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 6.71E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 8.71E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 2.11E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 6.76E-07 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 6.03E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 7.42E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 6.91E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994 NA 1.36E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251