Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909042994:

Variant ID: vg0909042994 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9042994
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGGAAAATGTAACGGTAGGGGCATGGAAGGGATCAAATTGAAATTTCAGGGGTATAGAAGGGATCAGATAAATTTCAGGGGTATGAAAGAGATTGAGT[G/A]
AGCTTTCAGGGGTACACAGGAAATTTACTCTTTTCCTAAATCTCGAAGATGATATAAAGTTTGGGAGATGCAGTGATGGTGATTATACGGTTAGTCGTGA

Reverse complement sequence

TCACGACTAACCGTATAATCACCATCACTGCATCTCCCAAACTTTATATCATCTTCGAGATTTAGGAAAAGAGTAAATTTCCTGTGTACCCCTGAAAGCT[C/T]
ACTCAATCTCTTTCATACCCCTGAAATTTATCTGATCCCTTCTATACCCCTGAAATTTCAATTTGATCCCTTCCATGCCCCTACCGTTACATTTTCCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.80%	2.10%	8.06%	55.01%	NA
All Indica	2759	9.30%	1.40%	6.34%	82.93%	NA
All Japonica	1512	85.90%	3.70%	0.79%	9.59%	NA
Aus	269	4.50%	0.70%	55.02%	39.78%	NA
Indica I	595	6.10%	1.30%	3.87%	88.74%	NA
Indica II	465	5.20%	0.60%	10.97%	83.23%	NA
Indica III	913	15.00%	1.50%	3.72%	79.74%	NA
Indica Intermediate	786	7.60%	1.80%	8.52%	82.06%	NA
Temperate Japonica	767	87.00%	6.90%	0.13%	6.00%	NA
Tropical Japonica	504	92.30%	0.00%	0.60%	7.14%	NA
Japonica Intermediate	241	69.30%	1.20%	3.32%	26.14%	NA
VI/Aromatic	96	22.90%	3.10%	34.38%	39.58%	NA
Intermediate	90	61.10%	0.00%	14.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909042994	G -> DEL	N	N	silent_mutation	Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0909042994	G -> A	LOC_Os09g15010.1	upstream_gene_variant ; 1868.0bp to feature; MODIFIER	silent_mutation	Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0909042994	G -> A	LOC_Os09g15010-LOC_Os09g15020	intergenic_region ; MODIFIER	silent_mutation	Average:41.338; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909042994	2.00E-06	5.51E-06	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	6.75E-06	NA	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	6.89E-06	NA	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	9.14E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	2.69E-07	3.52E-07	mr1395	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	4.34E-06	5.86E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	5.51E-07	3.82E-06	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	5.39E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	3.92E-24	mr1888	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	6.71E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	8.71E-06	NA	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	2.11E-06	NA	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	6.76E-07	NA	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	6.03E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	7.42E-06	NA	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	6.91E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909042994	NA	1.36E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251