\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909036057:

Variant ID: vg0909036057 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9036057
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTATACCCGTTTCGCGAAACCGGGAACGGCCCAATGATGTCCTGTCCCCATCTGGCAAAGGGCCATATTGGCGCAATGGGCTGCAAATCATACTGGGGCG[T/C]
GGCTTGGCTTCGGCCATGACGCTGGCAACTTTCGCACTTCTTGATTTGCTCAACACAGACTTTCAACATAGTGGGCCAATAAACTCCTTGTCTAAATACT

Reverse complement sequence

AGTATTTAGACAAGGAGTTTATTGGCCCACTATGTTGAAAGTCTGTGTTGAGCAAATCAAGAAGTGCGAAAGTTGCCAGCGTCATGGCCGAAGCCAAGCC[A/G]
CGCCCCAGTATGATTTGCAGCCCATTGCGCCAATATGGCCCTTTGCCAGATGGGGACAGGACATCATTGGGCCGTTCCCGGTTTCGCGAAACGGGTATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 0.50% 6.37% 51.18% NA
All Indica  2759 13.30% 0.60% 5.62% 80.50% NA
All Japonica  1512 89.40% 0.30% 3.77% 6.61% NA
Aus  269 61.30% 0.40% 23.42% 14.87% NA
Indica I  595 9.60% 0.20% 5.04% 85.21% NA
Indica II  465 6.90% 0.40% 4.09% 88.60% NA
Indica III  913 17.90% 0.80% 6.57% 74.81% NA
Indica Intermediate  786 14.50% 0.90% 5.85% 78.75% NA
Temperate Japonica  767 94.00% 0.00% 1.83% 4.17% NA
Tropical Japonica  504 92.30% 0.20% 2.18% 5.36% NA
Japonica Intermediate  241 68.50% 1.20% 13.28% 17.01% NA
VI/Aromatic  96 40.60% 1.00% 18.75% 39.58% NA
Intermediate  90 68.90% 0.00% 8.89% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909036057 T -> DEL N N silent_mutation Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg0909036057 T -> C LOC_Os09g15000.1 downstream_gene_variant ; 1344.0bp to feature; MODIFIER silent_mutation Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg0909036057 T -> C LOC_Os09g15010.1 intron_variant ; MODIFIER silent_mutation Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909036057 4.40E-06 NA mr1280 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 2.25E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 1.45E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 8.53E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 3.89E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 2.81E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 2.44E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057 NA 3.43E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251