\
| Variant ID: vg0909036057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9036057 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 76. )
TTATACCCGTTTCGCGAAACCGGGAACGGCCCAATGATGTCCTGTCCCCATCTGGCAAAGGGCCATATTGGCGCAATGGGCTGCAAATCATACTGGGGCG[T/C]
GGCTTGGCTTCGGCCATGACGCTGGCAACTTTCGCACTTCTTGATTTGCTCAACACAGACTTTCAACATAGTGGGCCAATAAACTCCTTGTCTAAATACT
AGTATTTAGACAAGGAGTTTATTGGCCCACTATGTTGAAAGTCTGTGTTGAGCAAATCAAGAAGTGCGAAAGTTGCCAGCGTCATGGCCGAAGCCAAGCC[A/G]
CGCCCCAGTATGATTTGCAGCCCATTGCGCCAATATGGCCCTTTGCCAGATGGGGACAGGACATCATTGGGCCGTTCCCGGTTTCGCGAAACGGGTATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 0.50% | 6.37% | 51.18% | NA |
| All Indica | 2759 | 13.30% | 0.60% | 5.62% | 80.50% | NA |
| All Japonica | 1512 | 89.40% | 0.30% | 3.77% | 6.61% | NA |
| Aus | 269 | 61.30% | 0.40% | 23.42% | 14.87% | NA |
| Indica I | 595 | 9.60% | 0.20% | 5.04% | 85.21% | NA |
| Indica II | 465 | 6.90% | 0.40% | 4.09% | 88.60% | NA |
| Indica III | 913 | 17.90% | 0.80% | 6.57% | 74.81% | NA |
| Indica Intermediate | 786 | 14.50% | 0.90% | 5.85% | 78.75% | NA |
| Temperate Japonica | 767 | 94.00% | 0.00% | 1.83% | 4.17% | NA |
| Tropical Japonica | 504 | 92.30% | 0.20% | 2.18% | 5.36% | NA |
| Japonica Intermediate | 241 | 68.50% | 1.20% | 13.28% | 17.01% | NA |
| VI/Aromatic | 96 | 40.60% | 1.00% | 18.75% | 39.58% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 8.89% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909036057 | T -> DEL | N | N | silent_mutation | Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg0909036057 | T -> C | LOC_Os09g15000.1 | downstream_gene_variant ; 1344.0bp to feature; MODIFIER | silent_mutation | Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg0909036057 | T -> C | LOC_Os09g15010.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909036057 | 4.40E-06 | NA | mr1280 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 2.25E-08 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 1.45E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 8.53E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 3.89E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 2.81E-12 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 2.44E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909036057 | NA | 3.43E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |