\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909014180:

Variant ID: vg0909014180 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9014180
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAATACTAAGGGTAGAGTTCAATACATGTGGAAGGTGAAGGTTCCATATGGCATACGATGGAGGTATTGTGTGCGTATGGGATGCGGAGTCGAATTTG[G/A]
AGGGAGTCCAAATTTGGTATAATTGATTATGTAAAGTTTGTTTCTTGTACTAGAGGGTTTCCTATGGGGATTAGGACTTCTAGTATGAGTTTGGTTCGTG

Reverse complement sequence

CACGAACCAAACTCATACTAGAAGTCCTAATCCCCATAGGAAACCCTCTAGTACAAGAAACAAACTTTACATAATCAATTATACCAAATTTGGACTCCCT[C/T]
CAAATTCGACTCCGCATCCCATACGCACACAATACCTCCATCGTATGCCATATGGAACCTTCACCTTCCACATGTATTGAACTCTACCCTTAGTATTCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 32.90% 1.23% 8.04% NA
All Indica  2759 88.90% 6.80% 0.98% 3.37% NA
All Japonica  1512 0.90% 79.40% 1.92% 17.79% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 89.90% 8.10% 0.34% 1.68% NA
Indica II  465 89.50% 9.90% 0.43% 0.22% NA
Indica III  913 88.20% 4.30% 1.10% 6.46% NA
Indica Intermediate  786 88.50% 6.90% 1.65% 2.93% NA
Temperate Japonica  767 0.50% 73.40% 1.56% 24.51% NA
Tropical Japonica  504 0.80% 87.10% 3.17% 8.93% NA
Japonica Intermediate  241 2.10% 82.60% 0.41% 14.94% NA
VI/Aromatic  96 8.30% 77.10% 0.00% 14.58% NA
Intermediate  90 33.30% 60.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909014180 G -> DEL N N silent_mutation Average:44.467; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0909014180 G -> A LOC_Os09g14990-LOC_Os09g15000 intergenic_region ; MODIFIER silent_mutation Average:44.467; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909014180 NA 8.56E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 4.70E-14 mr1172 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 2.67E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 9.35E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 1.41E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 3.63E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 1.76E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 1.85E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 7.94E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 6.81E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 1.11E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 7.36E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 6.86E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 2.33E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 5.16E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 2.60E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 5.66E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 4.06E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 8.06E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 3.97E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 2.75E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 2.16E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 1.04E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909014180 NA 7.49E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251