\
| Variant ID: vg0909013229 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9013229 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACTGTTGGACCTTGCACGGAGAGTTAGGGGTTGCAATAGAAGAGGATGAAGAAGAAGACGATAACATTTCGGACTGGGTTCAATACGGTGGATTTGCA[G/A]
AAAATACAATAGGCGTGGCGGACAGTGCTATTGAAGAAAACAAGGGTGCGGATGATCTTGGTCGGAGTTGTGTGACGTAAAGAAGGACTACGAAAGTGGA
TCCACTTTCGTAGTCCTTCTTTACGTCACACAACTCCGACCAAGATCATCCGCACCCTTGTTTTCTTCAATAGCACTGTCCGCCACGCCTATTGTATTTT[C/T]
TGCAAATCCACCGTATTGAACCCAGTCCGAAATGTTATCGTCTTCTTCTTCATCCTCTTCTATTGCAACCCCTAACTCTCCGTGCAAGGTCCAACAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 4.50% | 1.78% | 6.79% | NA |
| All Indica | 2759 | 92.50% | 3.60% | 1.34% | 2.50% | NA |
| All Japonica | 1512 | 74.00% | 7.40% | 2.91% | 15.67% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 4.40% | 0.17% | 1.68% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 89.80% | 3.40% | 3.18% | 3.61% | NA |
| Indica Intermediate | 786 | 91.60% | 4.50% | 0.89% | 3.05% | NA |
| Temperate Japonica | 767 | 69.90% | 6.30% | 1.43% | 22.43% | NA |
| Tropical Japonica | 504 | 86.10% | 1.40% | 6.15% | 6.35% | NA |
| Japonica Intermediate | 241 | 61.80% | 23.70% | 0.83% | 13.69% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 1.04% | 12.50% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909013229 | G -> DEL | N | N | silent_mutation | Average:38.25; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg0909013229 | G -> A | LOC_Os09g14990-LOC_Os09g15000 | intergenic_region ; MODIFIER | silent_mutation | Average:38.25; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909013229 | NA | 4.48E-09 | mr1280 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909013229 | NA | 8.01E-08 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909013229 | NA | 1.44E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909013229 | NA | 2.88E-06 | mr1788 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909013229 | NA | 5.49E-06 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |