\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909011341:

Variant ID: vg0909011341 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9011341
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.24, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAGTTGTGCTCGAGACTGGTATGGAGGGGCACCACTATATCGATACAAGACCCATGTTTCAAGGAAACACACAGAAAGTAAGTTTTGCTGCTACAAT[C/T]
GACTTCACCCAGCAGAGGGACATTTATATTTCACTTTAACGATTTGGAAAATAAGTCAGACATGAACACTTAGGTGCAGTGGATAATTTAGTGTATTAAT

Reverse complement sequence

ATTAATACACTAAATTATCCACTGCACCTAAGTGTTCATGTCTGACTTATTTTCCAAATCGTTAAAGTGAAATATAAATGTCCCTCTGCTGGGTGAAGTC[G/A]
ATTGTAGCAGCAAAACTTACTTTCTGTGTGTTTCCTTGAAACATGGGTCTTGTATCGATATAGTGGTGCCCCTCCATACCAGTCTCGAGCACAACTTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 31.90% 0.13% 9.16% NA
All Indica  2759 89.70% 6.10% 0.11% 4.17% NA
All Japonica  1512 0.90% 79.30% 0.13% 19.64% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 90.40% 7.40% 0.17% 2.02% NA
Indica II  465 90.50% 9.00% 0.00% 0.43% NA
Indica III  913 88.80% 3.60% 0.00% 7.56% NA
Indica Intermediate  786 89.60% 6.10% 0.25% 4.07% NA
Temperate Japonica  767 0.70% 73.50% 0.26% 25.55% NA
Tropical Japonica  504 0.80% 86.70% 0.00% 12.50% NA
Japonica Intermediate  241 2.10% 82.20% 0.00% 15.77% NA
VI/Aromatic  96 6.20% 77.10% 1.04% 15.62% NA
Intermediate  90 32.20% 61.10% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909011341 C -> DEL N N silent_mutation Average:57.25; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N
vg0909011341 C -> T LOC_Os09g14990-LOC_Os09g15000 intergenic_region ; MODIFIER silent_mutation Average:57.25; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909011341 NA 2.02E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 5.20E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 4.40E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 6.72E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.36E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.65E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.94E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 8.19E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 9.05E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.53E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 8.34E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.55E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.61E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.88E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 4.63E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.46E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 7.89E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.19E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 5.71E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 4.57E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.11E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.43E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.59E-09 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.65E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.43E-14 mr1683 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.29E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.60E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.28E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.36E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.08E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.09E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.15E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.87E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.05E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 2.47E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.17E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 4.50E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 3.11E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909011341 NA 1.02E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251