Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909009783:

Variant ID: vg0909009783 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9009783
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATATACATAATATTTTCCTCATGTATACAAAATAAAATACATATCATTGGATCGGAAAAATAGTACATATGATTTGAAAGAGACAATAAAGCTTTC[G/A]
TCTTAGGAACGATAAAAAAGATAAAGCCGGGTGTAAAAACTAAAGCCAAAAAAAATACGTACATAGTATCATCCAAAAAAATCAAAAATATAATTTTCTG

Reverse complement sequence

CAGAAAATTATATTTTTGATTTTTTTGGATGATACTATGTACGTATTTTTTTTGGCTTTAGTTTTTACACCCGGCTTTATCTTTTTTATCGTTCCTAAGA[C/T]
GAAAGCTTTATTGTCTCTTTCAAATCATATGTACTATTTTTCCGATCCAATGATATGTATTTTATTTTGTATACATGAGGAAAATATTATGTATATATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 32.40% 1.42% 9.84% NA
All Indica  2759 86.50% 6.00% 2.17% 5.33% NA
All Japonica  1512 1.10% 79.10% 0.26% 19.58% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 91.10% 5.00% 1.85% 2.02% NA
Indica II  465 78.30% 9.50% 6.24% 6.02% NA
Indica III  913 87.70% 4.10% 0.66% 7.56% NA
Indica Intermediate  786 86.50% 6.90% 1.78% 4.83% NA
Temperate Japonica  767 0.70% 73.30% 0.26% 25.81% NA
Tropical Japonica  504 1.00% 86.50% 0.00% 12.50% NA
Japonica Intermediate  241 2.50% 82.20% 0.83% 14.52% NA
VI/Aromatic  96 6.20% 78.10% 1.04% 14.58% NA
Intermediate  90 31.10% 57.80% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909009783 G -> DEL N N silent_mutation Average:26.611; most accessible tissue: Callus, score: 58.805 N N N N
vg0909009783 G -> A LOC_Os09g14990-LOC_Os09g15000 intergenic_region ; MODIFIER silent_mutation Average:26.611; most accessible tissue: Callus, score: 58.805 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909009783 NA 1.90E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.89E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.18E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 7.45E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.92E-09 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.30E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.04E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 5.39E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.17E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.14E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 3.74E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.17E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 3.34E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.96E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.58E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 3.97E-10 mr1604 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 4.76E-09 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.41E-13 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.76E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.52E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.96E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.19E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.19E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.04E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.78E-09 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 8.53E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.30E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 4.93E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 6.11E-09 mr1886 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 3.78E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 2.34E-08 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 9.78E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909009783 NA 1.21E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251