\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909006841:

Variant ID: vg0909006841 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9006841
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.31, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAATTTTGGCTGCCTGCAAAAAATGGTTTTATCTAGTAGTGTAACAAGCCAGGTTATGTTCTTCACCCCACGCACTGGAACCTAACAAAAACAAGAT[A/G]
ATTAGATGATTAGTCTTTTGCTACCATTTTGTGCATCCGCAGAAGGATTTACGTTGCAACCAAGAAATAGTATCAAGGTATATATTAATTGAAAATATCT

Reverse complement sequence

AGATATTTTCAATTAATATATACCTTGATACTATTTCTTGGTTGCAACGTAAATCCTTCTGCGGATGCACAAAATGGTAGCAAAAGACTAATCATCTAAT[T/C]
ATCTTGTTTTTGTTAGGTTCCAGTGCGTGGGGTGAAGAACATAACCTGGCTTGTTACACTACTAGATAAAACCATTTTTTGCAGGCAGCCAAAATTAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 31.90% 0.15% 8.38% NA
All Indica  2759 91.60% 4.50% 0.11% 3.84% NA
All Japonica  1512 1.40% 80.50% 0.20% 17.92% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 98.20% 0.30% 0.00% 1.51% NA
Indica II  465 90.50% 9.00% 0.00% 0.43% NA
Indica III  913 89.40% 3.20% 0.33% 7.12% NA
Indica Intermediate  786 89.70% 6.50% 0.00% 3.82% NA
Temperate Japonica  767 1.20% 73.00% 0.39% 25.42% NA
Tropical Japonica  504 0.80% 90.70% 0.00% 8.53% NA
Japonica Intermediate  241 3.30% 83.00% 0.00% 13.69% NA
VI/Aromatic  96 8.30% 77.10% 1.04% 13.54% NA
Intermediate  90 37.80% 55.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909006841 A -> G LOC_Os09g14990-LOC_Os09g15000 intergenic_region ; MODIFIER silent_mutation Average:48.751; most accessible tissue: Zhenshan97 flower, score: 58.048 N N N N
vg0909006841 A -> DEL N N silent_mutation Average:48.751; most accessible tissue: Zhenshan97 flower, score: 58.048 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909006841 NA 1.36E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0909006841 NA 1.51E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 3.50E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 1.03E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 1.69E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 5.48E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 1.49E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 6.73E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 1.10E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 5.46E-06 mr1535 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 2.51E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 9.19E-09 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 1.29E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 6.56E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 8.17E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 2.59E-09 mr1979 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 2.23E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909006841 NA 4.34E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251