\
| Variant ID: vg0908998893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8998893 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGTGTGATGACTAGTGCTTCTAACCATATGGACCTCTATTGCGATAATAGCGGTGCCATTGCGCAAGCCAAGGAGCCTAGATCGCATCAAAAGCCCAAA[C/T]
ACATTTTACGGCGGTATCACTTCATTTGCGAGATAGTGGGTAGAGGAGATGTGAAGATATGCAAAATACATACGGATTTGAATGTTGCAGATCCATTGAC
GTCAATGGATCTGCAACATTCAAATCCGTATGTATTTTGCATATCTTCACATCTCCTCTACCCACTATCTCGCAAATGAAGTGATACCGCCGTAAAATGT[G/A]
TTTGGGCTTTTGATGCGATCTAGGCTCCTTGGCTTGCGCAATGGCACCGCTATTATCGCAATAGAGGTCCATATGGTTAGAAGCACTAGTCATCACACCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 28.80% | 1.76% | 7.89% | NA |
| All Indica | 2759 | 91.70% | 3.30% | 1.63% | 3.33% | NA |
| All Japonica | 1512 | 2.80% | 79.20% | 0.46% | 17.53% | NA |
| Aus | 269 | 85.10% | 4.50% | 10.41% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.20% | 0.00% | 1.51% | NA |
| Indica II | 465 | 90.50% | 3.20% | 5.81% | 0.43% | NA |
| Indica III | 913 | 89.50% | 3.50% | 0.99% | 6.02% | NA |
| Indica Intermediate | 786 | 90.10% | 5.50% | 1.15% | 3.31% | NA |
| Temperate Japonica | 767 | 0.90% | 73.40% | 0.39% | 25.29% | NA |
| Tropical Japonica | 504 | 4.40% | 87.10% | 0.40% | 8.13% | NA |
| Japonica Intermediate | 241 | 5.40% | 81.30% | 0.83% | 12.45% | NA |
| VI/Aromatic | 96 | 66.70% | 20.80% | 2.08% | 10.42% | NA |
| Intermediate | 90 | 45.60% | 46.70% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908998893 | C -> DEL | N | N | silent_mutation | Average:23.349; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg0908998893 | C -> T | LOC_Os09g14990.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:23.349; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg0908998893 | C -> T | LOC_Os09g14990-LOC_Os09g15000 | intergenic_region ; MODIFIER | silent_mutation | Average:23.349; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908998893 | NA | 3.10E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0908998893 | NA | 1.71E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908998893 | NA | 8.30E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908998893 | NA | 7.92E-17 | mr1924 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |