\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908964730:

Variant ID: vg0908964730 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8964730
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCATATAAAGGGCAAATCCCATCTTGATTATTCATATCCCACTACATGTTTCATAGCATACCCGAAAACTACTTTTATAACTACCCAATTATGGAGTAA[C/T,G]
CACTACACCGGAGCTATTCACCTGTGACGGGCCCTAACCATCACCTTTGACGGGTTTGAGTCTGGTCACAGATTAATGGTCACTGATAAGTCCCAGTCAC

Reverse complement sequence

GTGACTGGGACTTATCAGTGACCATTAATCTGTGACCAGACTCAAACCCGTCAAAGGTGATGGTTAGGGCCCGTCACAGGTGAATAGCTCCGGTGTAGTG[G/A,C]
TTACTCCATAATTGGGTAGTTATAAAAGTAGTTTTCGGGTATGCTATGAAACATGTAGTGGGATATGAATAATCAAGATGGGATTTGCCCTTTATATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 9.70% 43.88% 14.43% G: 0.23%
All Indica  2759 24.60% 15.40% 55.27% 4.68% NA
All Japonica  1512 48.10% 0.30% 16.40% 34.52% G: 0.73%
Aus  269 4.80% 8.90% 85.50% 0.74% NA
Indica I  595 9.90% 20.30% 64.20% 5.55% NA
Indica II  465 50.30% 6.20% 35.91% 7.53% NA
Indica III  913 18.80% 19.90% 57.50% 3.72% NA
Indica Intermediate  786 27.20% 12.00% 57.38% 3.44% NA
Temperate Japonica  767 80.20% 0.10% 6.78% 12.78% G: 0.13%
Tropical Japonica  504 8.70% 0.60% 27.78% 61.31% G: 1.59%
Japonica Intermediate  241 28.20% 0.00% 23.24% 47.72% G: 0.83%
VI/Aromatic  96 40.60% 2.10% 29.17% 28.12% NA
Intermediate  90 45.60% 4.40% 47.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908964730 C -> G LOC_Os09g14950.1 upstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> G LOC_Os09g14960.1 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> G LOC_Os09g14960.2 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> G LOC_Os09g14940-LOC_Os09g14950 intergenic_region ; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> DEL N N silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> T LOC_Os09g14950.1 upstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> T LOC_Os09g14960.1 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> T LOC_Os09g14960.2 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0908964730 C -> T LOC_Os09g14940-LOC_Os09g14950 intergenic_region ; MODIFIER silent_mutation Average:88.44; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0908964730 C G 0.0 0.0 0.0 0.0 0.0 0.0
vg0908964730 C T -0.02 -0.02 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908964730 NA 7.50E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.59E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 7.85E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.06E-17 mr1149 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.27E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 8.73E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.97E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.40E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 7.19E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.29E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.04E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 6.42E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.68E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.90E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.93E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.61E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 2.34E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.61E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 5.12E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.64E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.76E-30 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 6.83E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 2.34E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 8.95E-30 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.61E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 2.74E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 1.52E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.40E-20 mr1592_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 4.26E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.17E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.73E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 9.45E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 7.83E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.66E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 7.83E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908964730 NA 3.66E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251