\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908960274:

Variant ID: vg0908960274 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8960274
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTTAAGGTGCCATATAGTAGTTCTATATATATATATATATATATCACCATGGTGCCTGGGCATCATGGTATGAAATACACAAATTCGTTCAAATTTTT[C/T]
AAAATTTTCAAATTGTGAGTATATACCTAGTTGTAAGAACTCGATTCATACCTATACCTAGCAATAAACAACTCAAATTTAACTTTATTTCACAATACAA

Reverse complement sequence

TTGTATTGTGAAATAAAGTTAAATTTGAGTTGTTTATTGCTAGGTATAGGTATGAATCGAGTTCTTACAACTAGGTATATACTCACAATTTGAAAATTTT[G/A]
AAAAATTTGAACGAATTTGTGTATTTCATACCATGATGCCCAGGCACCATGGTGATATATATATATATATATATAGAACTACTATATGGCACCTTAAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 0.50% 16.06% 41.07% NA
All Indica  2759 14.60% 0.60% 17.91% 66.91% NA
All Japonica  1512 93.30% 0.00% 2.45% 4.23% NA
Aus  269 27.50% 3.00% 63.20% 6.32% NA
Indica I  595 9.40% 0.50% 7.06% 83.03% NA
Indica II  465 22.60% 1.10% 34.62% 41.72% NA
Indica III  913 14.50% 0.70% 12.05% 72.84% NA
Indica Intermediate  786 14.00% 0.30% 23.03% 62.72% NA
Temperate Japonica  767 94.50% 0.00% 2.22% 3.26% NA
Tropical Japonica  504 98.20% 0.00% 0.99% 0.79% NA
Japonica Intermediate  241 79.30% 0.00% 6.22% 14.52% NA
VI/Aromatic  96 57.30% 0.00% 39.58% 3.12% NA
Intermediate  90 65.60% 0.00% 22.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908960274 C -> DEL N N silent_mutation Average:37.183; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0908960274 C -> T LOC_Os09g14940-LOC_Os09g14950 intergenic_region ; MODIFIER silent_mutation Average:37.183; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908960274 NA 2.29E-06 mr1194_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 3.83E-06 NA mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 1.18E-08 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 4.92E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 5.60E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 4.92E-06 4.90E-06 mr1643_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 5.31E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 2.79E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 1.50E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 3.02E-06 mr1922_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908960274 NA 1.24E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251