Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0908951187:

Variant ID: vg0908951187 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8951187
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGCGATATTCCATATACTAAGTCTGATTAATTAAGTAACACAAATAATAATAAACAGAATTCATGCAATAAAAAAATACTATGTAATAATAGTTGACCT[A/C]
ACAAAAGTGTACTTTAGTCTATGATGTTTAACTATATATACTAATTATATTTTTGTAATTGTGCTCTTATTTTATTTTTAATTCATTTCTTCATAGAAAA

Reverse complement sequence

TTTTCTATGAAGAAATGAATTAAAAATAAAATAAGAGCACAATTACAAAAATATAATTAGTATATATAGTTAAACATCATAGACTAAAGTACACTTTTGT[T/G]
AGGTCAACTATTATTACATAGTATTTTTTTATTGCATGAATTCTGTTTATTATTATTTGTGTTACTTAATTAATCAGACTTAGTATATGGAATATCGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	0.60%	1.59%	32.27%	NA
All Indica	2759	43.90%	0.00%	1.27%	54.84%	NA
All Japonica	1512	95.40%	1.80%	2.58%	0.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	18.50%	0.00%	1.01%	80.50%	NA
Indica II	465	72.00%	0.00%	1.94%	26.02%	NA
Indica III	913	39.80%	0.00%	0.99%	59.26%	NA
Indica Intermediate	786	51.10%	0.10%	1.40%	47.33%	NA
Temperate Japonica	767	92.20%	3.30%	4.43%	0.13%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	97.10%	0.80%	2.07%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	91.10%	0.00%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908951187	A -> DEL	N	N	silent_mutation	Average:20.395; most accessible tissue: Callus, score: 59.13	N	N	N	N
vg0908951187	A -> C	LOC_Os09g14930.1	upstream_gene_variant ; 4425.0bp to feature; MODIFIER	silent_mutation	Average:20.395; most accessible tissue: Callus, score: 59.13	N	N	N	N
vg0908951187	A -> C	LOC_Os09g14940.1	upstream_gene_variant ; 3064.0bp to feature; MODIFIER	silent_mutation	Average:20.395; most accessible tissue: Callus, score: 59.13	N	N	N	N
vg0908951187	A -> C	LOC_Os09g14940-LOC_Os09g14950	intergenic_region ; MODIFIER	silent_mutation	Average:20.395; most accessible tissue: Callus, score: 59.13	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908951187	4.31E-06	NA	mr1010_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251