\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908935995:

Variant ID: vg0908935995 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8935995
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGGCCCGTCACGGATAGGTGTCATCCATGACGGGCCTTAGTTTTACGTCCATCTAGCATGTCTGTGCGACCAATCTCAATAAGGTGTTTTTTTTGGCC[C/A]
GATTGAGATGACTTCCTTGTGACGGTACGCTAATTCCAGACATGTTAGAAGCCGTCACAGATGGAAGGTTTTGTACTGGTGCCATGATCATATTCCTCAT

Reverse complement sequence

ATGAGGAATATGATCATGGCACCAGTACAAAACCTTCCATCTGTGACGGCTTCTAACATGTCTGGAATTAGCGTACCGTCACAAGGAAGTCATCTCAATC[G/T]
GGCCAAAAAAAACACCTTATTGAGATTGGTCGCACAGACATGCTAGATGGACGTAAAACTAAGGCCCGTCATGGATGACACCTATCCGTGACGGGCCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 15.90% 0.85% 35.40% NA
All Indica  2759 37.80% 0.70% 1.45% 60.02% NA
All Japonica  1512 57.80% 41.90% 0.00% 0.33% NA
Aus  269 88.50% 10.80% 0.00% 0.74% NA
Indica I  595 17.50% 0.30% 1.68% 80.50% NA
Indica II  465 65.80% 0.40% 1.72% 32.04% NA
Indica III  913 29.80% 0.70% 1.42% 68.13% NA
Indica Intermediate  786 46.10% 1.10% 1.15% 51.65% NA
Temperate Japonica  767 91.40% 8.50% 0.00% 0.13% NA
Tropical Japonica  504 9.30% 89.90% 0.00% 0.79% NA
Japonica Intermediate  241 52.30% 47.70% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 41.70% 0.00% 1.04% NA
Intermediate  90 54.40% 35.60% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908935995 C -> DEL N N silent_mutation Average:25.972; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0908935995 C -> A LOC_Os09g14920-LOC_Os09g14930 intergenic_region ; MODIFIER silent_mutation Average:25.972; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908935995 NA 1.28E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.60E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.01E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.49E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 9.40E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.78E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.76E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 5.61E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.13E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 7.72E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 3.48E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 4.27E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 3.02E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.39E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.65E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.79E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 8.78E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 8.82E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 4.87E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.58E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.14E-25 mr1580 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.15E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.91E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 4.38E-09 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.52E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 5.23E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.49E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.20E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.30E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 3.61E-20 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.42E-06 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 8.09E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.32E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.34E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 8.32E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 4.37E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.36E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 4.96E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 1.19E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 2.22E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 6.57E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908935995 NA 3.61E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251