\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908903383:

Variant ID: vg0908903383 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8903383
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTAGATTGATCTAAAATCATGTTGATGTTCTTTTTACCATCAGAAAATCTTTGCAAGGAATTTTTCAAATAAGAAATCTCTTTTTCCAAATTAGCACA[A/G]
TTTTCACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCAACTCATTGGTTTTCACAACATCTTCCATGTACTCAACACAACCTA

Reverse complement sequence

TAGGTTGTGTTGAGTACATGGAAGATGTTGTGAAAACCAATGAGTTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTGAAAA[T/C]
TGTGCTAATTTGGAAAAAGAGATTTCTTATTTGAAAAATTCCTTGCAAAGATTTTCTGATGGTAAAAAGAACATCAACATGATTTTAGATCAATCTAAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 4.40% 14.05% 6.77% NA
All Indica  2759 64.40% 2.20% 22.94% 10.47% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.07% NA
Aus  269 28.60% 52.80% 8.18% 10.41% NA
Indica I  595 46.90% 0.50% 38.49% 14.12% NA
Indica II  465 87.50% 0.20% 9.68% 2.58% NA
Indica III  913 62.70% 1.30% 22.34% 13.69% NA
Indica Intermediate  786 66.00% 5.60% 19.72% 8.65% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 90.00% 3.30% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908903383 A -> G LOC_Os09g14900.1 synonymous_variant ; p.Asn291Asn; LOW synonymous_codon Average:17.226; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0908903383 A -> DEL LOC_Os09g14900.1 N frameshift_variant Average:17.226; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908903383 NA 8.25E-16 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 4.93E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 2.56E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 1.40E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 3.39E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 8.49E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 8.49E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 3.86E-06 2.17E-13 mr1499 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 1.15E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 1.87E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 1.80E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 9.79E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 4.54E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 1.43E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 3.50E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908903383 NA 9.42E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251