Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908892007:

Variant ID: vg0908892007 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8892007
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGTTCAACATGATGACAATGACTGCAAAATCCTACTGTTCTGATTCATCCATAGAAATATCTTGTTTGACGAATATTTCTAAGGTACACACTTCACTTA[A/G,T]
TTGGAGATCACACTGCAAAATTATTATAACCTGCCTCCCAAGTCCCAAATGAAAATTTATTTTGTGAACTATCCACAAGTACGTAGTGTCCTCTAAATAA

Reverse complement sequence

TTATTTAGAGGACACTACGTACTTGTGGATAGTTCACAAAATAAATTTTCATTTGGGACTTGGGAGGCAGGTTATAATAATTTTGCAGTGTGATCTCCAA[T/C,A]
TAAGTGAAGTGTGTACCTTAGAAATATTCGTCAAACAAGATATTTCTATGGATGAATCAGAACAGTAGGATTTTGCAGTCATTGTCATCATGTTGAACAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	20.70%	4.59%	14.71%	T: 0.15%
All Indica	2759	33.40%	35.10%	7.58%	23.63%	T: 0.25%
All Japonica	1512	97.50%	0.10%	0.07%	2.31%	NA
Aus	269	97.40%	0.40%	0.74%	1.49%	NA
Indica I	595	15.30%	27.60%	10.76%	46.22%	T: 0.17%
Indica II	465	65.20%	15.90%	3.01%	15.91%	NA
Indica III	913	24.20%	49.30%	8.43%	17.74%	T: 0.33%
Indica Intermediate	786	39.10%	35.80%	6.87%	17.94%	T: 0.38%
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	93.50%	0.40%	0.20%	5.95%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	84.40%	8.90%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908892007	A -> G	LOC_Os09g14890.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:23.906; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0908892007	A -> G	LOC_Os09g14890-LOC_Os09g14900	intergenic_region ; MODIFIER	silent_mutation	Average:23.906; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0908892007	A -> DEL	N	N	silent_mutation	Average:23.906; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0908892007	A -> T	LOC_Os09g14890.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:23.906; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0908892007	A -> T	LOC_Os09g14890-LOC_Os09g14900	intergenic_region ; MODIFIER	silent_mutation	Average:23.906; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908892007	NA	2.40E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908892007	1.00E-06	1.00E-06	mr1230	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251