\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908891592:

Variant ID: vg0908891592 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8891592
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCGACTAAAAAATATTATTACGGCAAAAAGAATAGTTTATTTTTCATCCATATCAGAACCATACATTCTTGATGAAATCTTAAATTTCACATCCAT[A/G]
TACTTTGTTGATCAAGTGCGGACAATGCACAATCATGTCCCTCGATACAAATGTCACTGCTTAGCCTACTGGTGGCTGTAGACCATGCATATCCTCATAT

Reverse complement sequence

ATATGAGGATATGCATGGTCTACAGCCACCAGTAGGCTAAGCAGTGACATTTGTATCGAGGGACATGATTGTGCATTGTCCGCACTTGATCAACAAAGTA[T/C]
ATGGATGTGAAATTTAAGATTTCATCAAGAATGTATGGTTCTGATATGGATGAAAAATAAACTATTCTTTTTGCCGTAATAATATTTTTTAGTCGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 22.00% 2.84% 18.20% NA
All Indica  2759 29.70% 37.30% 4.57% 28.45% NA
All Japonica  1512 96.30% 0.10% 0.20% 3.37% NA
Aus  269 95.20% 0.40% 0.00% 4.46% NA
Indica I  595 13.40% 29.90% 6.39% 50.25% NA
Indica II  465 60.20% 16.30% 4.52% 18.92% NA
Indica III  913 20.40% 51.90% 3.94% 23.77% NA
Indica Intermediate  786 34.90% 38.20% 3.94% 23.03% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 92.70% 0.40% 0.40% 6.55% NA
Japonica Intermediate  241 94.60% 0.00% 0.41% 4.98% NA
VI/Aromatic  96 87.50% 1.00% 3.12% 8.33% NA
Intermediate  90 83.30% 10.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908891592 A -> G LOC_Os09g14890.1 upstream_gene_variant ; 1457.0bp to feature; MODIFIER silent_mutation Average:29.367; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0908891592 A -> G LOC_Os09g14890-LOC_Os09g14900 intergenic_region ; MODIFIER silent_mutation Average:29.367; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0908891592 A -> DEL N N silent_mutation Average:29.367; most accessible tissue: Minghui63 root, score: 57.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908891592 NA 8.74E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 2.61E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 3.62E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 2.70E-06 2.70E-06 mr1230 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.47E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 3.28E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 4.18E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 3.41E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.30E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.18E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 2.92E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 3.74E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 8.68E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 3.84E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.21E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.49E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 4.71E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 1.87E-39 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 5.61E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 7.82E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 4.83E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 9.22E-11 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908891592 NA 9.22E-11 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251