\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908878751:

Variant ID: vg0908878751 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8878751
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GCATAATGGATTTCAGCATTCAGAGATTTATCTGCTTGAACAAGTTGTGAAGCGGTATTCTCGTAGGAAATTTGGTTCGCTTAATTCATTATGTACTCGA[A/G]
GGAAAATGTGTTTTGCTCTTTGTGGGTTGGATAGTGTATAGGAAAAACCTCCCTTCAAAACTTCAAAATGACTCTTTTTAGGGGCTTCAGGCAGAGCTCA

Reverse complement sequence

TGAGCTCTGCCTGAAGCCCCTAAAAAGAGTCATTTTGAAGTTTTGAAGGGAGGTTTTTCCTATACACTATCCAACCCACAAAGAGCAAAACACATTTTCC[T/C]
TCGAGTACATAATGAATTAAGCGAACCAAATTTCCTACGAGAATACCGCTTCACAACTTGTTCAAGCAGATAAATCTCTGAATGCTGAAATCCATTATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 34.30% 1.82% 7.15% NA
All Indica  2759 27.50% 58.50% 2.57% 11.42% NA
All Japonica  1512 99.10% 0.00% 0.46% 0.46% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 8.60% 82.00% 1.01% 8.40% NA
Indica II  465 55.50% 24.10% 5.38% 15.05% NA
Indica III  913 20.00% 66.80% 2.19% 10.95% NA
Indica Intermediate  786 34.10% 51.30% 2.54% 12.09% NA
Temperate Japonica  767 98.70% 0.00% 0.91% 0.39% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 0.00% 3.12% 5.21% NA
Intermediate  90 77.80% 6.70% 5.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908878751 A -> G LOC_Os09g14870.1 downstream_gene_variant ; 4883.0bp to feature; MODIFIER silent_mutation Average:67.599; most accessible tissue: Callus, score: 87.855 N N N N
vg0908878751 A -> G LOC_Os09g14880.1 downstream_gene_variant ; 703.0bp to feature; MODIFIER silent_mutation Average:67.599; most accessible tissue: Callus, score: 87.855 N N N N
vg0908878751 A -> G LOC_Os09g14870-LOC_Os09g14880 intergenic_region ; MODIFIER silent_mutation Average:67.599; most accessible tissue: Callus, score: 87.855 N N N N
vg0908878751 A -> DEL N N silent_mutation Average:67.599; most accessible tissue: Callus, score: 87.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0908878751 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908878751 NA 1.03E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 8.98E-06 mr1330 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 2.19E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 1.90E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 1.06E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 2.96E-15 mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 8.24E-07 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 6.32E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 3.91E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 8.66E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 5.79E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 6.46E-06 mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 2.40E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 8.12E-37 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 9.14E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 1.08E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878751 NA 9.24E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251