Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908878156:

Variant ID: vg0908878156 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8878156
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAAATTCCTAGGAGAGATCAATAAATATTGTGAAATTGGTTCAAAATAATTTTTAAGGATAGTAAAAATTCCTCCACAGTTTGGAGGAATTCTAACAT[A/G]
TGGTCTTGCCTTACAAATCCCCTCGAGAACTCCAATGCACTTCTTCTCTATCTTACTCCCTTCTCTCTCTAATAAATCAACATATAAATCTTATTAAATT

Reverse complement sequence

AATTTAATAAGATTTATATGTTGATTTATTAGAGAGAGAAGGGAGTAAGATAGAGAAGAAGTGCATTGGAGTTCTCGAGGGGATTTGTAAGGCAAGACCA[T/C]
ATGTTAGAATTCCTCCAAACTGTGGAGGAATTTTTACTATCCTTAAAAATTATTTTGAACCAATTTCACAATATTTATTGATCTCTCCTAGGAATTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	35.50%	0.63%	15.64%	NA
All Indica	2759	16.60%	60.50%	1.09%	21.86%	NA
All Japonica	1512	95.50%	0.00%	0.00%	4.50%	NA
Aus	269	98.50%	0.00%	0.00%	1.49%	NA
Indica I	595	7.10%	84.90%	0.84%	7.23%	NA
Indica II	465	34.00%	25.40%	1.08%	39.57%	NA
Indica III	913	9.70%	68.60%	1.20%	20.48%	NA
Indica Intermediate	786	21.40%	53.40%	1.15%	24.05%	NA
Temperate Japonica	767	97.70%	0.00%	0.00%	2.35%	NA
Tropical Japonica	504	91.50%	0.00%	0.00%	8.53%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	61.50%	0.00%	0.00%	38.54%	NA
Intermediate	90	62.20%	7.80%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908878156	A -> G	LOC_Os09g14870.1	downstream_gene_variant ; 4288.0bp to feature; MODIFIER	silent_mutation	Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0908878156	A -> G	LOC_Os09g14880.1	downstream_gene_variant ; 1298.0bp to feature; MODIFIER	silent_mutation	Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0908878156	A -> G	LOC_Os09g14870-LOC_Os09g14880	intergenic_region ; MODIFIER	silent_mutation	Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0908878156	A -> DEL	N	N	silent_mutation	Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908878156	NA	7.74E-09	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	2.63E-08	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	8.05E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	1.90E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.69E-11	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	3.51E-22	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	4.32E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	2.58E-13	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.57E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	7.63E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	3.42E-07	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	3.56E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	7.69E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	2.41E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	8.40E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	3.36E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	1.15E-44	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	3.78E-13	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	6.81E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	4.10E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	1.45E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.81E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.87E-11	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.98E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.87E-11	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156	NA	9.98E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251