\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908878156:

Variant ID: vg0908878156 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8878156
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAATTCCTAGGAGAGATCAATAAATATTGTGAAATTGGTTCAAAATAATTTTTAAGGATAGTAAAAATTCCTCCACAGTTTGGAGGAATTCTAACAT[A/G]
TGGTCTTGCCTTACAAATCCCCTCGAGAACTCCAATGCACTTCTTCTCTATCTTACTCCCTTCTCTCTCTAATAAATCAACATATAAATCTTATTAAATT

Reverse complement sequence

AATTTAATAAGATTTATATGTTGATTTATTAGAGAGAGAAGGGAGTAAGATAGAGAAGAAGTGCATTGGAGTTCTCGAGGGGATTTGTAAGGCAAGACCA[T/C]
ATGTTAGAATTCCTCCAAACTGTGGAGGAATTTTTACTATCCTTAAAAATTATTTTGAACCAATTTCACAATATTTATTGATCTCTCCTAGGAATTTCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 35.50% 0.63% 15.64% NA
All Indica  2759 16.60% 60.50% 1.09% 21.86% NA
All Japonica  1512 95.50% 0.00% 0.00% 4.50% NA
Aus  269 98.50% 0.00% 0.00% 1.49% NA
Indica I  595 7.10% 84.90% 0.84% 7.23% NA
Indica II  465 34.00% 25.40% 1.08% 39.57% NA
Indica III  913 9.70% 68.60% 1.20% 20.48% NA
Indica Intermediate  786 21.40% 53.40% 1.15% 24.05% NA
Temperate Japonica  767 97.70% 0.00% 0.00% 2.35% NA
Tropical Japonica  504 91.50% 0.00% 0.00% 8.53% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 61.50% 0.00% 0.00% 38.54% NA
Intermediate  90 62.20% 7.80% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908878156 A -> G LOC_Os09g14870.1 downstream_gene_variant ; 4288.0bp to feature; MODIFIER silent_mutation Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0908878156 A -> G LOC_Os09g14880.1 downstream_gene_variant ; 1298.0bp to feature; MODIFIER silent_mutation Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0908878156 A -> G LOC_Os09g14870-LOC_Os09g14880 intergenic_region ; MODIFIER silent_mutation Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0908878156 A -> DEL N N silent_mutation Average:60.848; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908878156 NA 7.74E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 2.63E-08 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 8.05E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 1.90E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.69E-11 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 3.51E-22 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 4.32E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 2.58E-13 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.57E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 7.63E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 3.42E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 3.56E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 7.69E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 2.41E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 8.40E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 3.36E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 1.15E-44 mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 3.78E-13 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 6.81E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 4.10E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 1.45E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.81E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.87E-11 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.98E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.87E-11 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878156 NA 9.98E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251