Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908878056:

Variant ID: vg0908878056 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8878056
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGGAGACATCAGGAGATCACAGTTTATACAAGAATGGCTAAGGGCTACTTTGGATTGAAGGGACTCCATTGGAAAACTAGAGGAATTCGATCCAAAC[G/A,C]
AGAAATTCCTAGGAGAGATCAATAAATATTGTGAAATTGGTTCAAAATAATTTTTAAGGATAGTAAAAATTCCTCCACAGTTTGGAGGAATTCTAACATA

Reverse complement sequence

TATGTTAGAATTCCTCCAAACTGTGGAGGAATTTTTACTATCCTTAAAAATTATTTTGAACCAATTTCACAATATTTATTGATCTCTCCTAGGAATTTCT[C/T,G]
GTTTGGATCGAATTCCTCTAGTTTTCCAATGGAGTCCCTTCAATCCAAAGTAGCCCTTAGCCATTCTTGTATAAACTGTGATCTCCTGATGTCTCCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	35.60%	0.78%	14.88%	C: 0.02%
All Indica	2759	16.30%	60.70%	0.94%	22.00%	NA
All Japonica	1512	97.40%	0.10%	0.07%	2.45%	C: 0.07%
Aus	269	98.50%	0.00%	0.00%	1.49%	NA
Indica I	595	7.20%	84.70%	0.67%	7.39%	NA
Indica II	465	32.70%	25.80%	1.72%	39.78%	NA
Indica III	913	9.50%	68.70%	0.88%	20.92%	NA
Indica Intermediate	786	21.50%	53.90%	0.76%	23.79%	NA
Temperate Japonica	767	97.40%	0.00%	0.13%	2.35%	C: 0.13%
Tropical Japonica	504	96.80%	0.00%	0.00%	3.17%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	61.50%	0.00%	6.25%	32.29%	NA
Intermediate	90	62.20%	6.70%	4.44%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908878056	G -> DEL	N	N	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> C	LOC_Os09g14870.1	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> C	LOC_Os09g14880.1	downstream_gene_variant ; 1398.0bp to feature; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> C	LOC_Os09g14870-LOC_Os09g14880	intergenic_region ; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> A	LOC_Os09g14870.1	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> A	LOC_Os09g14880.1	downstream_gene_variant ; 1398.0bp to feature; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg0908878056	G -> A	LOC_Os09g14870-LOC_Os09g14880	intergenic_region ; MODIFIER	silent_mutation	Average:63.79; most accessible tissue: Callus, score: 82.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908878056	NA	7.04E-08	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	4.62E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	4.99E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	3.17E-20	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	1.17E-13	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	1.01E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	2.42E-11	mr1794	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	2.92E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	5.41E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	5.26E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	6.06E-06	mr1362_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	1.33E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	1.14E-38	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	3.70E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	1.42E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	4.03E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	2.26E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	3.69E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	2.64E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908878056	NA	2.64E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251