\
| Variant ID: vg0908878056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8878056 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )
CTTGGGAGACATCAGGAGATCACAGTTTATACAAGAATGGCTAAGGGCTACTTTGGATTGAAGGGACTCCATTGGAAAACTAGAGGAATTCGATCCAAAC[G/A,C]
AGAAATTCCTAGGAGAGATCAATAAATATTGTGAAATTGGTTCAAAATAATTTTTAAGGATAGTAAAAATTCCTCCACAGTTTGGAGGAATTCTAACATA
TATGTTAGAATTCCTCCAAACTGTGGAGGAATTTTTACTATCCTTAAAAATTATTTTGAACCAATTTCACAATATTTATTGATCTCTCCTAGGAATTTCT[C/T,G]
GTTTGGATCGAATTCCTCTAGTTTTCCAATGGAGTCCCTTCAATCCAAAGTAGCCCTTAGCCATTCTTGTATAAACTGTGATCTCCTGATGTCTCCCAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 35.60% | 0.78% | 14.88% | C: 0.02% |
| All Indica | 2759 | 16.30% | 60.70% | 0.94% | 22.00% | NA |
| All Japonica | 1512 | 97.40% | 0.10% | 0.07% | 2.45% | C: 0.07% |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 7.20% | 84.70% | 0.67% | 7.39% | NA |
| Indica II | 465 | 32.70% | 25.80% | 1.72% | 39.78% | NA |
| Indica III | 913 | 9.50% | 68.70% | 0.88% | 20.92% | NA |
| Indica Intermediate | 786 | 21.50% | 53.90% | 0.76% | 23.79% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.13% | 2.35% | C: 0.13% |
| Tropical Japonica | 504 | 96.80% | 0.00% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 6.25% | 32.29% | NA |
| Intermediate | 90 | 62.20% | 6.70% | 4.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908878056 | G -> DEL | N | N | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> C | LOC_Os09g14870.1 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> C | LOC_Os09g14880.1 | downstream_gene_variant ; 1398.0bp to feature; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> C | LOC_Os09g14870-LOC_Os09g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> A | LOC_Os09g14870.1 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> A | LOC_Os09g14880.1 | downstream_gene_variant ; 1398.0bp to feature; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| vg0908878056 | G -> A | LOC_Os09g14870-LOC_Os09g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:63.79; most accessible tissue: Callus, score: 82.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908878056 | NA | 7.04E-08 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 4.62E-08 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 4.99E-09 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 3.17E-20 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 1.17E-13 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 1.01E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 2.42E-11 | mr1794 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 2.92E-09 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 5.41E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 5.26E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 6.06E-06 | mr1362_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 1.33E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 1.14E-38 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 3.70E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 1.42E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 4.03E-09 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 2.26E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 3.69E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 2.64E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908878056 | NA | 2.64E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |