\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908874352:

Variant ID: vg0908874352 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8874352
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.43, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCAAAACTTATGTAACGAACTTTACTAAGTCAAGCTTGTACTCATTAACAGTACTGTTAAAAACTGTCAGTGTTGTTTTTCTATCATTTAAGTTTGTT[A/G]
TGATCTGCTGTATGGAACATTTCTTGAAATCTGAGGAAATATTTTGAGTCATTACTACAAGAAAAATACTTTGTAGAGACATTTTTCTAGTACTGTAGAG

Reverse complement sequence

CTCTACAGTACTAGAAAAATGTCTCTACAAAGTATTTTTCTTGTAGTAATGACTCAAAATATTTCCTCAGATTTCAAGAAATGTTCCATACAGCAGATCA[T/C]
AACAAACTTAAATGATAGAAAAACAACACTGACAGTTTTTAACAGTACTGTTAATGAGTACAAGCTTGACTTAGTAAAGTTCGTTACATAAGTTTTGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 30.90% 0.08% 0.21% NA
All Indica  2759 71.80% 27.70% 0.14% 0.33% NA
All Japonica  1512 57.90% 42.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.60% 8.70% 0.34% 0.34% NA
Indica II  465 35.70% 64.10% 0.00% 0.22% NA
Indica III  913 78.50% 20.90% 0.11% 0.44% NA
Indica Intermediate  786 71.10% 28.50% 0.13% 0.25% NA
Temperate Japonica  767 26.30% 73.70% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 28.10% 0.00% 1.04% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908874352 A -> G LOC_Os09g14870.1 downstream_gene_variant ; 484.0bp to feature; MODIFIER silent_mutation Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0908874352 A -> G LOC_Os09g14870-LOC_Os09g14880 intergenic_region ; MODIFIER silent_mutation Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0908874352 A -> DEL N N silent_mutation Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908874352 NA 3.62E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908874352 NA 7.58E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 3.92E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.59E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.42E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 2.04E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 2.16E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 4.02E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 2.62E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.14E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.63E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 3.00E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 7.82E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 4.65E-10 mr1295_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.13E-11 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.36E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 6.91E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 2.74E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 8.80E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 4.72E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352 NA 1.18E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251