\
| Variant ID: vg0908874352 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8874352 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.43, others allele: 0.00, population size: 86. )
AAGCAAAACTTATGTAACGAACTTTACTAAGTCAAGCTTGTACTCATTAACAGTACTGTTAAAAACTGTCAGTGTTGTTTTTCTATCATTTAAGTTTGTT[A/G]
TGATCTGCTGTATGGAACATTTCTTGAAATCTGAGGAAATATTTTGAGTCATTACTACAAGAAAAATACTTTGTAGAGACATTTTTCTAGTACTGTAGAG
CTCTACAGTACTAGAAAAATGTCTCTACAAAGTATTTTTCTTGTAGTAATGACTCAAAATATTTCCTCAGATTTCAAGAAATGTTCCATACAGCAGATCA[T/C]
AACAAACTTAAATGATAGAAAAACAACACTGACAGTTTTTAACAGTACTGTTAATGAGTACAAGCTTGACTTAGTAAAGTTCGTTACATAAGTTTTGCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.80% | 30.90% | 0.08% | 0.21% | NA |
| All Indica | 2759 | 71.80% | 27.70% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 57.90% | 42.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 8.70% | 0.34% | 0.34% | NA |
| Indica II | 465 | 35.70% | 64.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 78.50% | 20.90% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 71.10% | 28.50% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 26.30% | 73.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 25.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 28.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908874352 | A -> G | LOC_Os09g14870.1 | downstream_gene_variant ; 484.0bp to feature; MODIFIER | silent_mutation | Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0908874352 | A -> G | LOC_Os09g14870-LOC_Os09g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0908874352 | A -> DEL | N | N | silent_mutation | Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908874352 | NA | 3.62E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0908874352 | NA | 7.58E-06 | mr1042 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 3.92E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.59E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.42E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 2.04E-08 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 2.16E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 4.02E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 2.62E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.14E-08 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.63E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 3.00E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 7.82E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 4.65E-10 | mr1295_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.13E-11 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.36E-07 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 6.91E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 2.74E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 8.80E-07 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 4.72E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908874352 | NA | 1.18E-08 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |