\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908782045:

Variant ID: vg0908782045 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8782045
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAAACGGAATCGAATATTATCGAATACAGATACGGAGCGAATACAAATCGAAACGAATTTGGTAACGAATATTAATCGGAACATAAAAGCCCCTCAAA[T/C]
TGACCTTCACAAATCAACGAAGAAATATAACTCGTTATTTTTTTTAATAGAACATATCAACATTTTCAATTTTAGTGTTAATAATTTTGTTATATCCGAT

Reverse complement sequence

ATCGGATATAACAAAATTATTAACACTAAAATTGAAAATGTTGATATGTTCTATTAAAAAAAATAACGAGTTATATTTCTTCGTTGATTTGTGAAGGTCA[A/G]
TTTGAGGGGCTTTTATGTTCCGATTAATATTCGTTACCAAATTCGTTTCGATTTGTATTCGCTCCGTATCTGTATTCGATAATATTCGATTCCGTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 16.10% 0.34% 40.44% NA
All Indica  2759 41.00% 0.80% 0.54% 57.67% NA
All Japonica  1512 49.90% 44.40% 0.00% 5.69% NA
Aus  269 20.40% 10.80% 0.37% 68.40% NA
Indica I  595 35.30% 0.50% 0.50% 63.70% NA
Indica II  465 73.10% 0.60% 0.65% 25.59% NA
Indica III  913 24.10% 0.50% 0.22% 75.14% NA
Indica Intermediate  786 45.90% 1.40% 0.89% 51.78% NA
Temperate Japonica  767 87.10% 8.50% 0.00% 4.43% NA
Tropical Japonica  504 2.00% 91.10% 0.00% 6.94% NA
Japonica Intermediate  241 32.00% 61.00% 0.00% 7.05% NA
VI/Aromatic  96 52.10% 11.50% 0.00% 36.46% NA
Intermediate  90 53.30% 30.00% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908782045 T -> DEL N N silent_mutation Average:20.206; most accessible tissue: Callus, score: 61.443 N N N N
vg0908782045 T -> C LOC_Os09g14770.1 downstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:20.206; most accessible tissue: Callus, score: 61.443 N N N N
vg0908782045 T -> C LOC_Os09g14760-LOC_Os09g14770 intergenic_region ; MODIFIER silent_mutation Average:20.206; most accessible tissue: Callus, score: 61.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908782045 3.77E-06 NA mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 9.19E-06 NA mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.82E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 1.01E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.61E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.51E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 3.15E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 2.78E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 2.45E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 1.53E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 7.09E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.47E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 9.05E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 9.66E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 3.96E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 5.20E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 1.24E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 3.89E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 1.47E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 7.01E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.98E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 6.35E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 9.62E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908782045 NA 1.78E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251