| Variant ID: vg0908762776 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8762776 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )
GTGGGCACCACAACACCAGAATTACATTTATCTAAAAACAACTATATATACTATTCCCCGTGCAAAAAAATAAAAAACTATACTATTTATCACAGCATCA[C/T]
TGCAGCACATGATGTGGTAGGCCCAGGACTACCCTAGAATTTGGCCTAGAGAAGACCAGGTATTCATTTTTCTTGGCCCATGAAAAAAGCCTGGTCCAAC
GTTGGACCAGGCTTTTTTCATGGGCCAAGAAAAATGAATACCTGGTCTTCTCTAGGCCAAATTCTAGGGTAGTCCTGGGCCTACCACATCATGTGCTGCA[G/A]
TGATGCTGTGATAAATAGTATAGTTTTTTATTTTTTTGCACGGGGAATAGTATATATAGTTGTTTTTAGATAAATGTAATTCTGGTGTTGTGGTGCCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 24.10% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 58.60% | 40.70% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 97.30% | 0.60% | 2.12% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.90% | 75.30% | 1.85% | 0.00% | NA |
| Indica II | 465 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.30% | 36.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 63.70% | 35.20% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 0.60% | 5.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908762776 | C -> T | LOC_Os09g14740.1 | upstream_gene_variant ; 4245.0bp to feature; MODIFIER | silent_mutation | Average:69.457; most accessible tissue: Callus, score: 96.325 | N | N | N | N |
| vg0908762776 | C -> T | LOC_Os09g14740-LOC_Os09g14750 | intergenic_region ; MODIFIER | silent_mutation | Average:69.457; most accessible tissue: Callus, score: 96.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908762776 | NA | 7.41E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 8.83E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 1.15E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 1.15E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 7.27E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 1.12E-12 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 1.09E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 1.18E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 3.13E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908762776 | NA | 3.96E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/