| Variant ID: vg0908755951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8755951 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGATGTTCTTGAAATATGTATCCAGAGCAGCTCTCAGCTTGTCGAAGATTTCCACAGTGTCGAACGAACTCGGACCATTAATATTAAAAAACATGGCCT[G/A]
GATAAGTGGTGTAGCAGCGTTGGCAACTTCATCCCTAGATCCTTCAAGCTTCTTAATTTTGTTGACCAAGACGTCGAATTGAGCTCGAGATTTAATTTTG
CAAAATTAAATCTCGAGCTCAATTCGACGTCTTGGTCAACAAAATTAAGAAGCTTGAAGGATCTAGGGATGAAGTTGCCAACGCTGCTACACCACTTATC[C/T]
AGGCCATGTTTTTTAATATTAATGGTCCGAGTTCGTTCGACACTGTGGAAATCTTCGACAAGCTGAGAGCTGCTCTGGATACATATTTCAAGAACATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 7.20% | 2.39% | 40.31% | NA |
| All Indica | 2759 | 40.30% | 0.10% | 1.78% | 57.77% | NA |
| All Japonica | 1512 | 69.30% | 21.40% | 3.57% | 5.75% | NA |
| Aus | 269 | 33.10% | 0.00% | 2.23% | 64.68% | NA |
| Indica I | 595 | 32.40% | 0.00% | 3.53% | 64.03% | NA |
| Indica II | 465 | 72.70% | 0.20% | 1.08% | 26.02% | NA |
| Indica III | 913 | 24.30% | 0.20% | 0.99% | 74.48% | NA |
| Indica Intermediate | 786 | 45.70% | 0.10% | 1.78% | 52.42% | NA |
| Temperate Japonica | 767 | 92.20% | 1.30% | 1.83% | 4.69% | NA |
| Tropical Japonica | 504 | 31.50% | 55.00% | 6.55% | 6.94% | NA |
| Japonica Intermediate | 241 | 75.50% | 14.90% | 2.90% | 6.64% | NA |
| VI/Aromatic | 96 | 63.50% | 0.00% | 1.04% | 35.42% | NA |
| Intermediate | 90 | 66.70% | 12.20% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908755951 | G -> DEL | LOC_Os09g14740.1 | N | frameshift_variant | Average:28.546; most accessible tissue: Zhenshan97 young leaf, score: 59.612 | N | N | N | N |
| vg0908755951 | G -> A | LOC_Os09g14740.1 | stop_gained ; p.Gln379*; HIGH | stop_gained | Average:28.546; most accessible tissue: Zhenshan97 young leaf, score: 59.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908755951 | NA | 6.79E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | NA | 1.19E-07 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | 6.24E-07 | NA | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | 1.76E-07 | 2.03E-11 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | NA | 8.14E-08 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | NA | 1.28E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | NA | 1.79E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | 2.58E-06 | 1.64E-10 | mr1642 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | 3.14E-06 | 1.75E-09 | mr1642 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908755951 | NA | 2.18E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/