\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908755951:

Variant ID: vg0908755951 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8755951
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATGTTCTTGAAATATGTATCCAGAGCAGCTCTCAGCTTGTCGAAGATTTCCACAGTGTCGAACGAACTCGGACCATTAATATTAAAAAACATGGCCT[G/A]
GATAAGTGGTGTAGCAGCGTTGGCAACTTCATCCCTAGATCCTTCAAGCTTCTTAATTTTGTTGACCAAGACGTCGAATTGAGCTCGAGATTTAATTTTG

Reverse complement sequence

CAAAATTAAATCTCGAGCTCAATTCGACGTCTTGGTCAACAAAATTAAGAAGCTTGAAGGATCTAGGGATGAAGTTGCCAACGCTGCTACACCACTTATC[C/T]
AGGCCATGTTTTTTAATATTAATGGTCCGAGTTCGTTCGACACTGTGGAAATCTTCGACAAGCTGAGAGCTGCTCTGGATACATATTTCAAGAACATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 7.20% 2.39% 40.31% NA
All Indica  2759 40.30% 0.10% 1.78% 57.77% NA
All Japonica  1512 69.30% 21.40% 3.57% 5.75% NA
Aus  269 33.10% 0.00% 2.23% 64.68% NA
Indica I  595 32.40% 0.00% 3.53% 64.03% NA
Indica II  465 72.70% 0.20% 1.08% 26.02% NA
Indica III  913 24.30% 0.20% 0.99% 74.48% NA
Indica Intermediate  786 45.70% 0.10% 1.78% 52.42% NA
Temperate Japonica  767 92.20% 1.30% 1.83% 4.69% NA
Tropical Japonica  504 31.50% 55.00% 6.55% 6.94% NA
Japonica Intermediate  241 75.50% 14.90% 2.90% 6.64% NA
VI/Aromatic  96 63.50% 0.00% 1.04% 35.42% NA
Intermediate  90 66.70% 12.20% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908755951 G -> DEL LOC_Os09g14740.1 N frameshift_variant Average:28.546; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0908755951 G -> A LOC_Os09g14740.1 stop_gained ; p.Gln379*; HIGH stop_gained Average:28.546; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908755951 NA 6.79E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.19E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 6.24E-07 NA mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 1.76E-07 2.03E-11 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 8.14E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.28E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.79E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 2.58E-06 1.64E-10 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 3.14E-06 1.75E-09 mr1642 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 2.18E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.25E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 4.50E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.66E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 6.62E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 4.62E-09 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.98E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 3.92E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.30E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 5.88E-06 6.75E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 8.46E-12 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 5.43E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 4.41E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 2.84E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 1.30E-06 4.48E-11 mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 3.46E-12 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 4.50E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 4.07E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 9.47E-07 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.83E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 7.78E-07 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 6.75E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.01E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 1.27E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908755951 NA 3.13E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251