\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908746391:

Variant ID: vg0908746391 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8746391
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATTCTTTGTCTTGTGAATAGGACAATAGATAACACGAGTTGGAGAAGTACGCTGAATTCCACGCTCTTTGCAGGCACGAATTTCGGCGTGTACGTTG[T/A]
GAAAAACCCAGCAGGCTTGCAAGGTGTGTTTTCTGGTTTTATGGATAGGACACCAGGACCTTGTCACCTCGGAAGTTATCCTCGTCGGGCCGTGATTCTT

Reverse complement sequence

AAGAATCACGGCCCGACGAGGATAACTTCCGAGGTGACAAGGTCCTGGTGTCCTATCCATAAAACCAGAAAACACACCTTGCAAGCCTGCTGGGTTTTTC[A/T]
CAACGTACACGCCGAAATTCGTGCCTGCAAAGAGCGTGGAATTCAGCGTACTTCTCCAACTCGTGTTATCTATTGTCCTATTCACAAGACAAAGAATCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 17.60% 1.42% 38.36% NA
All Indica  2759 40.50% 2.60% 2.25% 54.66% NA
All Japonica  1512 50.00% 44.80% 0.13% 5.03% NA
Aus  269 16.00% 16.70% 0.74% 66.54% NA
Indica I  595 36.60% 0.50% 1.51% 61.34% NA
Indica II  465 72.90% 0.40% 0.86% 25.81% NA
Indica III  913 23.30% 4.60% 3.72% 68.35% NA
Indica Intermediate  786 44.10% 3.20% 1.91% 50.76% NA
Temperate Japonica  767 87.00% 8.90% 0.00% 4.17% NA
Tropical Japonica  504 2.60% 91.50% 0.40% 5.56% NA
Japonica Intermediate  241 31.50% 61.80% 0.00% 6.64% NA
VI/Aromatic  96 51.00% 12.50% 1.04% 35.42% NA
Intermediate  90 53.30% 28.90% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908746391 T -> DEL N N silent_mutation Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0908746391 T -> A LOC_Os09g14730.1 upstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0908746391 T -> A LOC_Os09g14720.1 intron_variant ; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908746391 NA 4.45E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908746391 NA 4.21E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 6.59E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.35E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 7.44E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.42E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.18E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 9.50E-08 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 4.46E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 2.54E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 2.44E-08 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 3.95E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 3.21E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.77E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 4.07E-06 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.21E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 2.07E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.24E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 9.08E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 8.78E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 4.88E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.99E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 9.42E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 1.02E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 6.58E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 9.51E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391 NA 2.40E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251