Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908746391:

Variant ID: vg0908746391 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8746391
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGATTCTTTGTCTTGTGAATAGGACAATAGATAACACGAGTTGGAGAAGTACGCTGAATTCCACGCTCTTTGCAGGCACGAATTTCGGCGTGTACGTTG[T/A]
GAAAAACCCAGCAGGCTTGCAAGGTGTGTTTTCTGGTTTTATGGATAGGACACCAGGACCTTGTCACCTCGGAAGTTATCCTCGTCGGGCCGTGATTCTT

Reverse complement sequence

AAGAATCACGGCCCGACGAGGATAACTTCCGAGGTGACAAGGTCCTGGTGTCCTATCCATAAAACCAGAAAACACACCTTGCAAGCCTGCTGGGTTTTTC[A/T]
CAACGTACACGCCGAAATTCGTGCCTGCAAAGAGCGTGGAATTCAGCGTACTTCTCCAACTCGTGTTATCTATTGTCCTATTCACAAGACAAAGAATCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	17.60%	1.42%	38.36%	NA
All Indica	2759	40.50%	2.60%	2.25%	54.66%	NA
All Japonica	1512	50.00%	44.80%	0.13%	5.03%	NA
Aus	269	16.00%	16.70%	0.74%	66.54%	NA
Indica I	595	36.60%	0.50%	1.51%	61.34%	NA
Indica II	465	72.90%	0.40%	0.86%	25.81%	NA
Indica III	913	23.30%	4.60%	3.72%	68.35%	NA
Indica Intermediate	786	44.10%	3.20%	1.91%	50.76%	NA
Temperate Japonica	767	87.00%	8.90%	0.00%	4.17%	NA
Tropical Japonica	504	2.60%	91.50%	0.40%	5.56%	NA
Japonica Intermediate	241	31.50%	61.80%	0.00%	6.64%	NA
VI/Aromatic	96	51.00%	12.50%	1.04%	35.42%	NA
Intermediate	90	53.30%	28.90%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908746391	T -> DEL	N	N	silent_mutation	Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0908746391	T -> A	LOC_Os09g14730.1	upstream_gene_variant ; 4128.0bp to feature; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0908746391	T -> A	LOC_Os09g14720.1	intron_variant ; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908746391	NA	4.45E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908746391	NA	4.21E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	6.59E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.35E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	7.44E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.42E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.18E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	9.50E-08	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	4.46E-08	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	2.54E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	2.44E-08	mr1482	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	3.95E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	3.21E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.77E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	4.07E-06	mr1565	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.21E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	2.07E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.24E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	9.08E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	8.78E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	4.88E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.99E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	9.42E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	1.02E-07	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	6.58E-10	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	9.51E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908746391	NA	2.40E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251