\
| Variant ID: vg0908736502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8736502 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGGTATACCTTACCCGTAACCCTGACAGTAGCCCCTTACTTCTGCTTAAATGAACTCGTGTAACCGATCACGACTTCTGATGTCGAGGTTGTTGTCGTT[C/T]
TCGGTGTGAGGACCGTAGATATAGGGAGTAATCGACAACACCATGTGAAGCTCAACGGTCATGAGTGAATTTAAATTGAAGTCCGAAAAACTGCCGCGCG
CGCGCGGCAGTTTTTCGGACTTCAATTTAAATTCACTCATGACCGTTGAGCTTCACATGGTGTTGTCGATTACTCCCTATATCTACGGTCCTCACACCGA[G/A]
AACGACAACAACCTCGACATCAGAAGTCGTGATCGGTTACACGAGTTCATTTAAGCAGAAGTAAGGGGCTACTGTCAGGGTTACGGGTAAGGTATACCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.60% | 28.30% | 9.73% | 7.38% | NA |
| All Indica | 2759 | 32.80% | 42.60% | 15.51% | 9.10% | NA |
| All Japonica | 1512 | 93.30% | 0.50% | 0.73% | 5.42% | NA |
| Aus | 269 | 47.20% | 46.10% | 6.32% | 0.37% | NA |
| Indica I | 595 | 33.60% | 40.30% | 21.85% | 4.20% | NA |
| Indica II | 465 | 46.50% | 24.70% | 13.33% | 15.48% | NA |
| Indica III | 913 | 23.20% | 55.60% | 13.03% | 8.11% | NA |
| Indica Intermediate | 786 | 35.40% | 39.60% | 14.89% | 10.18% | NA |
| Temperate Japonica | 767 | 92.30% | 0.50% | 0.91% | 6.26% | NA |
| Tropical Japonica | 504 | 93.70% | 0.60% | 0.79% | 4.96% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 62.50% | 25.00% | 3.12% | 9.38% | NA |
| Intermediate | 90 | 83.30% | 8.90% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908736502 | C -> DEL | N | N | silent_mutation | Average:46.239; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0908736502 | C -> T | LOC_Os09g14710.1 | upstream_gene_variant ; 316.0bp to feature; MODIFIER | silent_mutation | Average:46.239; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0908736502 | C -> T | LOC_Os09g14720.1 | downstream_gene_variant ; 4195.0bp to feature; MODIFIER | silent_mutation | Average:46.239; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0908736502 | C -> T | LOC_Os09g14700-LOC_Os09g14710 | intergenic_region ; MODIFIER | silent_mutation | Average:46.239; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908736502 | NA | 2.32E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908736502 | 4.35E-06 | 2.64E-07 | mr1323_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908736502 | NA | 2.26E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908736502 | NA | 9.75E-06 | mr1483_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |