\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908710872:

Variant ID: vg0908710872 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8710872
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGACATGAAGCATCACGGTAACCCTGGAAACATGAAACAATAATGTTATGCGATAAAAATAATGATCCAGACAGTACAGGATGACTTAAATCTTAC[G/A]
AAGGTGGTTAATTATAATTGTTCAGCACTGTGAAGGACTTGAGGGTCTGCTTGCTATTTCTCCCAGGTAGCCATGGCAGAACAAACAAGCATAGACTCAG

Reverse complement sequence

CTGAGTCTATGCTTGTTTGTTCTGCCATGGCTACCTGGGAGAAATAGCAAGCAGACCCTCAAGTCCTTCACAGTGCTGAACAATTATAATTAACCACCTT[C/T]
GTAAGATTTAAGTCATCCTGTACTGTCTGGATCATTATTTTTATCGCATAACATTATTGTTTCATGTTTCCAGGGTTACCGTGATGCTTCATGTCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.30% 0.06% 0.15% NA
All Indica  2759 30.20% 69.50% 0.07% 0.25% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 8.40% 91.10% 0.17% 0.34% NA
Indica II  465 69.70% 30.30% 0.00% 0.00% NA
Indica III  913 20.90% 78.90% 0.00% 0.22% NA
Indica Intermediate  786 34.00% 65.50% 0.13% 0.38% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908710872 G -> DEL N N silent_mutation Average:73.308; most accessible tissue: Zhenshan97 flower, score: 86.841 N N N N
vg0908710872 G -> A LOC_Os09g14680.1 intron_variant ; MODIFIER silent_mutation Average:73.308; most accessible tissue: Zhenshan97 flower, score: 86.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908710872 NA 8.90E-15 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 3.85E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 8.41E-06 4.88E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 2.72E-08 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 2.34E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 7.92E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 5.68E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 1.36E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 2.97E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 5.53E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 5.54E-10 mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 3.30E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 1.51E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 4.09E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 5.96E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 3.16E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 2.21E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908710872 NA 2.21E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251