\
| Variant ID: vg0908710872 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8710872 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 259. )
AAAAAGACATGAAGCATCACGGTAACCCTGGAAACATGAAACAATAATGTTATGCGATAAAAATAATGATCCAGACAGTACAGGATGACTTAAATCTTAC[G/A]
AAGGTGGTTAATTATAATTGTTCAGCACTGTGAAGGACTTGAGGGTCTGCTTGCTATTTCTCCCAGGTAGCCATGGCAGAACAAACAAGCATAGACTCAG
CTGAGTCTATGCTTGTTTGTTCTGCCATGGCTACCTGGGAGAAATAGCAAGCAGACCCTCAAGTCCTTCACAGTGCTGAACAATTATAATTAACCACCTT[C/T]
GTAAGATTTAAGTCATCCTGTACTGTCTGGATCATTATTTTTATCGCATAACATTATTGTTTCATGTTTCCAGGGTTACCGTGATGCTTCATGTCTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.30% | 0.06% | 0.15% | NA |
| All Indica | 2759 | 30.20% | 69.50% | 0.07% | 0.25% | NA |
| All Japonica | 1512 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 8.40% | 91.10% | 0.17% | 0.34% | NA |
| Indica II | 465 | 69.70% | 30.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 20.90% | 78.90% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 34.00% | 65.50% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908710872 | G -> DEL | N | N | silent_mutation | Average:73.308; most accessible tissue: Zhenshan97 flower, score: 86.841 | N | N | N | N |
| vg0908710872 | G -> A | LOC_Os09g14680.1 | intron_variant ; MODIFIER | silent_mutation | Average:73.308; most accessible tissue: Zhenshan97 flower, score: 86.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908710872 | NA | 8.90E-15 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 3.85E-07 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | 8.41E-06 | 4.88E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 2.72E-08 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 2.34E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 7.92E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 5.68E-10 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 1.36E-13 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 2.97E-18 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 5.53E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 5.54E-10 | mr1836 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 3.30E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 1.51E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 4.09E-36 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 5.96E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 3.16E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 2.21E-10 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908710872 | NA | 2.21E-10 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |