\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908706109:

Variant ID: vg0908706109 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8706109
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TAATATTATGAATATATGGTTAAAAATATGTCCAAAAGATAAAGGTGCCATATTAAAACTCAGAGAGTGTAAGGTGTGTTTTTTTTTCTTTTTTTACTTA[C/A]
CATGGATTTCTTCCTGATGTTGACATTAGACAGTTGGAAGGGAAGTGATCGCGGTTGTCTGTGCTACGCAATGACCGACACTTTCAGTTGATTGGAAAGC

Reverse complement sequence

GCTTTCCAATCAACTGAAAGTGTCGGTCATTGCGTAGCACAGACAACCGCGATCACTTCCCTTCCAACTGTCTAATGTCAACATCAGGAAGAAATCCATG[G/T]
TAAGTAAAAAAAGAAAAAAAAACACACCTTACACTCTCTGAGTTTTAATATGGCACCTTTATCTTTTGGACATATTTTTAACCATATATTCATAATATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 1.40% 1.90% 60.94% NA
All Indica  2759 28.20% 1.40% 1.30% 69.01% NA
All Japonica  1512 48.30% 0.90% 0.20% 50.53% NA
Aus  269 12.30% 4.10% 18.59% 65.06% NA
Indica I  595 10.60% 1.70% 1.51% 86.22% NA
Indica II  465 63.90% 0.40% 0.43% 35.27% NA
Indica III  913 20.40% 2.00% 1.64% 76.01% NA
Indica Intermediate  786 29.60% 1.30% 1.27% 67.81% NA
Temperate Japonica  767 83.40% 0.00% 0.00% 16.56% NA
Tropical Japonica  504 2.60% 2.20% 0.60% 94.64% NA
Japonica Intermediate  241 32.40% 1.20% 0.00% 66.39% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 62.20% 0.00% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908706109 C -> DEL N N silent_mutation Average:84.456; most accessible tissue: Zhenshan97 flower, score: 95.757 N N N N
vg0908706109 C -> A LOC_Os09g14680.1 downstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:84.456; most accessible tissue: Zhenshan97 flower, score: 95.757 N N N N
vg0908706109 C -> A LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:84.456; most accessible tissue: Zhenshan97 flower, score: 95.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0908706109 C A 0.07 0.04 0.01 -0.06 0.08 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908706109 NA 1.31E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908706109 NA 8.18E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.48E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 4.16E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.80E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.19E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 4.28E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 4.02E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.51E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.42E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.36E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.19E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 2.90E-06 2.90E-06 mr1836 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.40E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 6.21E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 3.31E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 5.15E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.85E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 1.19E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 3.03E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 7.55E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.24E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.74E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.37E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 9.57E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 2.01E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908706109 NA 5.45E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251