Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908699614:

Variant ID: vg0908699614 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8699614
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GGATATCCTATATAATCTAAGTCAATATCGGTGCTTAACCTAATCGGCTGCCTTCTAGTAATAGACGTTAGCCGATTGAAGGTTAGATAGCAATATTGCT[A/G,T]
GAGATTATATAAGATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATGAAGATGAAAGCACTAATCCCGAGAACGCAAGCCGCCATAA

Reverse complement sequence

TTATGGCGGCTTGCGTTCTCGGGATTAGTGCTTTCATCTTCATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATCTTATATAATCTC[T/C,A]
AGCAATATTGCTATCTAACCTTCAATCGGCTAACGTCTATTACTAGAAGGCAGCCGATTAGGTTAAGCACCGATATTGACTTAGATTATATAGGATATCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	16.80%	15.28%	28.99%	T: 1.04%
All Indica	2759	30.20%	21.50%	19.57%	28.09%	T: 0.69%
All Japonica	1512	51.50%	0.80%	8.27%	37.50%	T: 1.98%
Aus	269	14.50%	66.90%	16.36%	2.23%	NA
Indica I	595	12.60%	14.10%	19.83%	52.77%	T: 0.67%
Indica II	465	65.40%	5.60%	9.25%	19.35%	T: 0.43%
Indica III	913	23.80%	34.10%	24.32%	16.65%	T: 1.20%
Indica Intermediate	786	30.00%	21.90%	19.97%	27.86%	T: 0.25%
Temperate Japonica	767	84.10%	0.90%	1.56%	13.43%	NA
Tropical Japonica	504	10.10%	0.60%	19.25%	64.09%	T: 5.95%
Japonica Intermediate	241	34.00%	0.80%	6.64%	58.51%	NA
VI/Aromatic	96	88.50%	2.10%	2.08%	7.29%	NA
Intermediate	90	61.10%	10.00%	12.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908699614	A -> G	LOC_Os09g14670.1	upstream_gene_variant ; 2041.0bp to feature; MODIFIER	silent_mutation	Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0908699614	A -> G	LOC_Os09g14670-LOC_Os09g14680	intergenic_region ; MODIFIER	silent_mutation	Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0908699614	A -> DEL	N	N	silent_mutation	Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0908699614	A -> T	LOC_Os09g14670.1	upstream_gene_variant ; 2041.0bp to feature; MODIFIER	silent_mutation	Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0908699614	A -> T	LOC_Os09g14670-LOC_Os09g14680	intergenic_region ; MODIFIER	silent_mutation	Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908699614	NA	9.89E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	4.63E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	2.94E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.79E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.36E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	2.75E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	9.94E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.41E-06	mr1362_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	4.67E-06	mr1415_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.64E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.45E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	4.21E-08	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	4.87E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	7.93E-06	mr1562_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	5.47E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.19E-07	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	2.86E-36	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	7.32E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	2.39E-10	mr1649_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	2.12E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	1.34E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	4.12E-08	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614	NA	9.63E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251