\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908699614:

Variant ID: vg0908699614 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8699614
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GGATATCCTATATAATCTAAGTCAATATCGGTGCTTAACCTAATCGGCTGCCTTCTAGTAATAGACGTTAGCCGATTGAAGGTTAGATAGCAATATTGCT[A/G,T]
GAGATTATATAAGATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATGAAGATGAAAGCACTAATCCCGAGAACGCAAGCCGCCATAA

Reverse complement sequence

TTATGGCGGCTTGCGTTCTCGGGATTAGTGCTTTCATCTTCATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATCTTATATAATCTC[T/C,A]
AGCAATATTGCTATCTAACCTTCAATCGGCTAACGTCTATTACTAGAAGGCAGCCGATTAGGTTAAGCACCGATATTGACTTAGATTATATAGGATATCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 16.80% 15.28% 28.99% T: 1.04%
All Indica  2759 30.20% 21.50% 19.57% 28.09% T: 0.69%
All Japonica  1512 51.50% 0.80% 8.27% 37.50% T: 1.98%
Aus  269 14.50% 66.90% 16.36% 2.23% NA
Indica I  595 12.60% 14.10% 19.83% 52.77% T: 0.67%
Indica II  465 65.40% 5.60% 9.25% 19.35% T: 0.43%
Indica III  913 23.80% 34.10% 24.32% 16.65% T: 1.20%
Indica Intermediate  786 30.00% 21.90% 19.97% 27.86% T: 0.25%
Temperate Japonica  767 84.10% 0.90% 1.56% 13.43% NA
Tropical Japonica  504 10.10% 0.60% 19.25% 64.09% T: 5.95%
Japonica Intermediate  241 34.00% 0.80% 6.64% 58.51% NA
VI/Aromatic  96 88.50% 2.10% 2.08% 7.29% NA
Intermediate  90 61.10% 10.00% 12.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908699614 A -> G LOC_Os09g14670.1 upstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0908699614 A -> G LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0908699614 A -> DEL N N silent_mutation Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0908699614 A -> T LOC_Os09g14670.1 upstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0908699614 A -> T LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:23.378; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908699614 NA 9.89E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 4.63E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 2.94E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.79E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.36E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 2.75E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 9.94E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.41E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 4.67E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.64E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.45E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 4.21E-08 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 4.87E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 7.93E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 5.47E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.19E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 2.86E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 7.32E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 2.39E-10 mr1649_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 2.12E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 1.34E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 4.12E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699614 NA 9.63E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251