\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908686139:

Variant ID: vg0908686139 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8686139
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGGGCGAGGAAAAAAATTGGCACGAGGGAAAGAAAAAACGGCGGCGCAGGCAAGAACAATCGCTTCGATTGGGAGCGCTTCTAGTTGTCCAATATTT[A/G]
GTTCAGGTTGGTCCTGGTTTTGGAGGTAGGTAAATTTTGGGACCATACTTAGAAGTCTGTTGGAGGGCTGATTTTTACCAAATTCCTAAAATTTATGTTT

Reverse complement sequence

AAACATAAATTTTAGGAATTTGGTAAAAATCAGCCCTCCAACAGACTTCTAAGTATGGTCCCAAAATTTACCTACCTCCAAAACCAGGACCAACCTGAAC[T/C]
AAATATTGGACAACTAGAAGCGCTCCCAATCGAAGCGATTGTTCTTGCCTGCGCCGCCGTTTTTTCTTTCCCTCGTGCCAATTTTTTTCCTCGCCCGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 40.60% 0.59% 0.13% NA
All Indica  2759 65.60% 33.80% 0.43% 0.18% NA
All Japonica  1512 48.20% 50.90% 0.86% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 87.70% 11.80% 0.34% 0.17% NA
Indica II  465 23.20% 76.30% 0.43% 0.00% NA
Indica III  913 76.10% 23.70% 0.22% 0.00% NA
Indica Intermediate  786 61.60% 37.20% 0.76% 0.51% NA
Temperate Japonica  767 11.20% 87.90% 0.91% 0.00% NA
Tropical Japonica  504 96.60% 2.80% 0.60% 0.00% NA
Japonica Intermediate  241 64.70% 34.00% 1.24% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 36.70% 60.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908686139 A -> G LOC_Os09g14640.1 upstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:73.112; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg0908686139 A -> G LOC_Os09g14650.1 downstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:73.112; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg0908686139 A -> G LOC_Os09g14660.1 downstream_gene_variant ; 3767.0bp to feature; MODIFIER silent_mutation Average:73.112; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg0908686139 A -> G LOC_Os09g14650-LOC_Os09g14660 intergenic_region ; MODIFIER silent_mutation Average:73.112; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg0908686139 A -> DEL N N silent_mutation Average:73.112; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0908686139 A G -0.01 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908686139 NA 1.24E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 7.29E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.90E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 2.87E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.01E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 9.37E-06 2.43E-09 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.77E-07 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 8.16E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.59E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 1.67E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 2.19E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 1.12E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 2.74E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.41E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.22E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 2.75E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 8.78E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 1.75E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.94E-08 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 2.41E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.20E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.97E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.47E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 1.86E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 1.86E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 3.85E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 4.93E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 4.47E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 5.96E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908686139 NA 6.64E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251