Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908683598:

Variant ID: vg0908683598 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8683598
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAAAAAAAACAACATACATTAAGTCAGAGAGCTAGCGAAAGAGCAAAATTCAGCACGCAAAGATGGGCCATACCCGCACAAATAGGCTCTCCACAGCC[G/A]
CGCAGCTTTCACCGAACTCGTTCAGTTCGGTGAAAAGCCTAAGGCCTTTGGTCGGCGCAATGACCTGGCACACCCCGTCCATGAACGGAGTGATCTCCGG

Reverse complement sequence

CCGGAGATCACTCCGTTCATGGACGGGGTGTGCCAGGTCATTGCGCCGACCAAAGGCCTTAGGCTTTTCACCGAACTGAACGAGTTCGGTGAAAGCTGCG[C/T]
GGCTGTGGAGAGCCTATTTGTGCGGGTATGGCCCATCTTTGCGTGCTGAATTTTGCTCTTTCGCTAGCTCTCTGACTTAATGTATGTTGTTTTTTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	31.80%	8.65%	14.26%	NA
All Indica	2759	39.60%	48.70%	8.08%	3.62%	NA
All Japonica	1512	53.00%	5.30%	4.70%	37.04%	NA
Aus	269	34.60%	22.70%	39.78%	2.97%	NA
Indica I	595	30.40%	41.70%	24.20%	3.70%	NA
Indica II	465	72.90%	21.30%	4.30%	1.51%	NA
Indica III	913	26.40%	67.00%	1.97%	4.60%	NA
Indica Intermediate	786	42.10%	49.00%	5.22%	3.69%	NA
Temperate Japonica	767	89.40%	0.30%	0.13%	10.17%	NA
Tropical Japonica	504	5.20%	4.80%	11.11%	78.97%	NA
Japonica Intermediate	241	36.90%	22.40%	5.81%	34.85%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	16.70%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908683598	G -> DEL	N	N	silent_mutation	Average:38.716; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0908683598	G -> A	LOC_Os09g14650.1	upstream_gene_variant ; 1459.0bp to feature; MODIFIER	silent_mutation	Average:38.716; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0908683598	G -> A	LOC_Os09g14630.1	downstream_gene_variant ; 2661.0bp to feature; MODIFIER	silent_mutation	Average:38.716; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0908683598	G -> A	LOC_Os09g14640.1	intron_variant ; MODIFIER	silent_mutation	Average:38.716; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908683598	NA	3.09E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	3.06E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	4.46E-09	mr1115	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	1.62E-08	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	7.75E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	3.16E-06	3.16E-06	mr1230	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	3.04E-06	NA	mr1231	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	7.81E-06	8.16E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	2.54E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	7.69E-06	mr1306	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	4.28E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	9.69E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	1.82E-07	mr1611	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	3.07E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	1.46E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	9.22E-10	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	8.97E-06	8.97E-06	mr1836	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	1.92E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683598	NA	7.18E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251