\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908683286:

Variant ID: vg0908683286 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8683286
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGGACTCTGTGGCTGGCACCATGGTTGCGGCCGTAGCTTCGGCCGACGCAAGACGGGCTTCGAGGGATTTAATCTTCTCCTCGGCCAAAGCAAGTTGT[T/C]
GGTCTCGTTCGGCGTCCCGCTGGCGTGATGCTTCCAGGTTAGAGCGGAGAGACCTGTTTTCGGCATTCGCCTTCTTCAAAGTCTCCGCCACCACATGCCT

Reverse complement sequence

AGGCATGTGGTGGCGGAGACTTTGAAGAAGGCGAATGCCGAAAACAGGTCTCTCCGCTCTAACCTGGAAGCATCACGCCAGCGGGACGCCGAACGAGACC[A/G]
ACAACTTGCTTTGGCCGAGGAGAAGATTAAATCCCTCGAAGCCCGTCTTGCGTCGGCCGAAGCTACGGCCGCAACCATGGTGCCAGCCACAGAGTCCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 36.10% 2.77% 19.81% NA
All Indica  2759 60.70% 28.00% 3.37% 7.94% NA
All Japonica  1512 9.90% 49.70% 1.85% 38.56% NA
Aus  269 37.90% 12.30% 2.60% 47.21% NA
Indica I  595 50.80% 10.30% 10.25% 28.74% NA
Indica II  465 35.50% 63.20% 0.65% 0.65% NA
Indica III  913 76.70% 20.60% 1.64% 1.10% NA
Indica Intermediate  786 64.50% 29.30% 1.78% 4.45% NA
Temperate Japonica  767 4.70% 84.40% 0.65% 10.30% NA
Tropical Japonica  504 8.50% 4.20% 4.17% 83.13% NA
Japonica Intermediate  241 29.00% 34.90% 0.83% 35.27% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 27.80% 61.10% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908683286 T -> DEL LOC_Os09g14640.1 N frameshift_variant Average:44.339; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0908683286 T -> C LOC_Os09g14640.1 missense_variant ; p.Gln381Arg; MODERATE stop_gained Average:44.339; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0908683286 T -> C LOC_Os09g14640.1 missense_variant ; p.Gln381Arg; MODERATE nonsynonymous_codon ; Q381R Average:44.339; most accessible tissue: Minghui63 flag leaf, score: 84.791 possibly damaging -1.549 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0908683286 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908683286 NA 2.63E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.21E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 8.80E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 2.56E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 4.05E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.32E-08 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 5.82E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 3.61E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 3.77E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 5.34E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.46E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 6.98E-11 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.28E-10 mr1570 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 7.83E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.43E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.13E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.54E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 1.88E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 4.85E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908683286 NA 3.90E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251