Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908682567:

Variant ID: vg0908682567 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8682567
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTCAAAAAAGAGAAGAGAATACAGACGAAGATCAACCCCGATTTCAAACAGAAACAATTAAATAGGCGAAAGGGTAATACTTTGCCAGTGGAATAGA[G/T]
ATTATATTAAGTACAAGGTGAATGCGGCTTAAAGCCGAACAGACCAAAAGTCTATATACAAAAGACTTAGGCTAAAAGAAGGTCCGAAAGGACCAAAGGA

Reverse complement sequence

TCCTTTGGTCCTTTCGGACCTTCTTTTAGCCTAAGTCTTTTGTATATAGACTTTTGGTCTGTTCGGCTTTAAGCCGCATTCACCTTGTACTTAATATAAT[C/A]
TCTATTCCACTGGCAAAGTATTACCCTTTCGCCTATTTAATTGTTTCTGTTTGAAATCGGGGTTGATCTTCGTCTGTATTCTCTTCTCTTTTTTGAACTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.30%	1.30%	3.83%	9.59%	NA
All Indica	2759	94.70%	0.90%	2.79%	1.59%	NA
All Japonica	1512	63.80%	2.40%	6.81%	26.98%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	0.70%	1.68%	0.00%	NA
Indica II	465	92.50%	0.40%	2.37%	4.73%	NA
Indica III	913	96.40%	0.00%	2.63%	0.99%	NA
Indica Intermediate	786	92.00%	2.30%	4.07%	1.65%	NA
Temperate Japonica	767	86.20%	4.40%	1.96%	7.43%	NA
Tropical Japonica	504	28.80%	0.00%	15.08%	56.15%	NA
Japonica Intermediate	241	66.00%	0.80%	4.98%	28.22%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908682567	G -> DEL	N	N	silent_mutation	Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0908682567	G -> T	LOC_Os09g14650.1	upstream_gene_variant ; 2490.0bp to feature; MODIFIER	silent_mutation	Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0908682567	G -> T	LOC_Os09g14630.1	downstream_gene_variant ; 1630.0bp to feature; MODIFIER	silent_mutation	Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0908682567	G -> T	LOC_Os09g14640.1	downstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0908682567	G -> T	LOC_Os09g14630-LOC_Os09g14640	intergenic_region ; MODIFIER	silent_mutation	Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908682567	NA	2.27E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908682567	2.71E-07	8.78E-09	mr1528_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251