\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908682567:

Variant ID: vg0908682567 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8682567
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCAAAAAAGAGAAGAGAATACAGACGAAGATCAACCCCGATTTCAAACAGAAACAATTAAATAGGCGAAAGGGTAATACTTTGCCAGTGGAATAGA[G/T]
ATTATATTAAGTACAAGGTGAATGCGGCTTAAAGCCGAACAGACCAAAAGTCTATATACAAAAGACTTAGGCTAAAAGAAGGTCCGAAAGGACCAAAGGA

Reverse complement sequence

TCCTTTGGTCCTTTCGGACCTTCTTTTAGCCTAAGTCTTTTGTATATAGACTTTTGGTCTGTTCGGCTTTAAGCCGCATTCACCTTGTACTTAATATAAT[C/A]
TCTATTCCACTGGCAAAGTATTACCCTTTCGCCTATTTAATTGTTTCTGTTTGAAATCGGGGTTGATCTTCGTCTGTATTCTCTTCTCTTTTTTGAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 1.30% 3.83% 9.59% NA
All Indica  2759 94.70% 0.90% 2.79% 1.59% NA
All Japonica  1512 63.80% 2.40% 6.81% 26.98% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 0.70% 1.68% 0.00% NA
Indica II  465 92.50% 0.40% 2.37% 4.73% NA
Indica III  913 96.40% 0.00% 2.63% 0.99% NA
Indica Intermediate  786 92.00% 2.30% 4.07% 1.65% NA
Temperate Japonica  767 86.20% 4.40% 1.96% 7.43% NA
Tropical Japonica  504 28.80% 0.00% 15.08% 56.15% NA
Japonica Intermediate  241 66.00% 0.80% 4.98% 28.22% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908682567 G -> DEL N N silent_mutation Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0908682567 G -> T LOC_Os09g14650.1 upstream_gene_variant ; 2490.0bp to feature; MODIFIER silent_mutation Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0908682567 G -> T LOC_Os09g14630.1 downstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0908682567 G -> T LOC_Os09g14640.1 downstream_gene_variant ; 141.0bp to feature; MODIFIER silent_mutation Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0908682567 G -> T LOC_Os09g14630-LOC_Os09g14640 intergenic_region ; MODIFIER silent_mutation Average:38.662; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908682567 NA 2.27E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908682567 2.71E-07 8.78E-09 mr1528_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251