\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908619472:

Variant ID: vg0908619472 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8619472
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.14, A: 0.12, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATATATAAATCTATTCAAAATCTAAAACGTCTTGTAACGCGAAACAAAGCAAAAGTGGCTAGTACTCCCTCCGTCCCTAAATATTTGACGCCGTTGA[A/C,T]
CTTTTTTAAACATGTTTGACCGTTCATCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATACATAAAAGTGTATTTAACAATGAATCAAAT

Reverse complement sequence

ATTTGATTCATTGTTAAATACACTTTTATGTATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGATGAACGGTCAAACATGTTTAAAAAAG[T/G,A]
TCAACGGCGTCAAATATTTAGGGACGGAGGGAGTACTAGCCACTTTTGCTTTGTTTCGCGTTACAAGACGTTTTAGATTTTGAATAGATTTATATATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.80% 0.30% 0.00% T: 0.02%
All Indica  2759 75.80% 23.90% 0.29% 0.00% NA
All Japonica  1512 54.10% 45.60% 0.33% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 89.40% 10.30% 0.34% 0.00% NA
Indica II  465 41.90% 57.80% 0.22% 0.00% NA
Indica III  913 85.90% 14.10% 0.00% 0.00% NA
Indica Intermediate  786 73.80% 25.60% 0.64% 0.00% NA
Temperate Japonica  767 18.60% 80.70% 0.65% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 50.00% 0.00% 0.00% T: 1.04%
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908619472 A -> T LOC_Os09g14550.1 downstream_gene_variant ; 1361.0bp to feature; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N
vg0908619472 A -> T LOC_Os09g14560.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N
vg0908619472 A -> T LOC_Os09g14550-LOC_Os09g14560 intergenic_region ; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N
vg0908619472 A -> C LOC_Os09g14550.1 downstream_gene_variant ; 1361.0bp to feature; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N
vg0908619472 A -> C LOC_Os09g14560.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N
vg0908619472 A -> C LOC_Os09g14550-LOC_Os09g14560 intergenic_region ; MODIFIER silent_mutation Average:25.974; most accessible tissue: Callus, score: 47.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908619472 NA 1.17E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 8.51E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 1.86E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 3.12E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 2.23E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 2.84E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 6.10E-09 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 4.47E-10 mr1295 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 1.84E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 3.21E-07 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 9.46E-06 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 7.64E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 2.13E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 9.21E-08 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 1.69E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472 NA 4.49E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251