\
| Variant ID: vg0908568026 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8568026 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGAGTGATATATTACATATTGATCTATCTTGTTCATATTTTTTCAATTTTTTTCATAATTATTTAAATGATATGCAATAAACGGGTAGACATCCACTCA[A/G]
GTTGTTAAAACAGTTTCCCTGTTATATATATTCTCTGGATCATTCTTGACTCTTGAGTGAGTTGGTTGAATCAGCGGAGGACGGTAACTATATTGCAGGG
CCCTGCAATATAGTTACCGTCCTCCGCTGATTCAACCAACTCACTCAAGAGTCAAGAATGATCCAGAGAATATATATAACAGGGAAACTGTTTTAACAAC[T/C]
TGAGTGGATGTCTACCCGTTTATTGCATATCATTTAAATAATTATGAAAAAAATTGAAAAAATATGAACAAGATAGATCAATATGTAATATATCACTCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 17.00% | 0.53% | 4.25% | NA |
| All Indica | 2759 | 91.10% | 0.80% | 0.83% | 7.25% | NA |
| All Japonica | 1512 | 49.70% | 50.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.50% | 0.00% | 0.84% | NA |
| Indica II | 465 | 89.20% | 0.40% | 0.22% | 10.11% | NA |
| Indica III | 913 | 87.30% | 0.70% | 2.08% | 9.97% | NA |
| Indica Intermediate | 786 | 91.60% | 0.80% | 0.38% | 7.25% | NA |
| Temperate Japonica | 767 | 82.50% | 17.20% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.90% | 70.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908568026 | A -> G | LOC_Os09g14500.1 | upstream_gene_variant ; 4645.0bp to feature; MODIFIER | silent_mutation | Average:63.861; most accessible tissue: Callus, score: 77.57 | N | N | N | N |
| vg0908568026 | A -> G | LOC_Os09g14480.1 | downstream_gene_variant ; 4252.0bp to feature; MODIFIER | silent_mutation | Average:63.861; most accessible tissue: Callus, score: 77.57 | N | N | N | N |
| vg0908568026 | A -> G | LOC_Os09g14490.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.861; most accessible tissue: Callus, score: 77.57 | N | N | N | N |
| vg0908568026 | A -> DEL | N | N | silent_mutation | Average:63.861; most accessible tissue: Callus, score: 77.57 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908568026 | NA | 4.13E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.87E-15 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 9.23E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.35E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.22E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 3.66E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 9.46E-08 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 8.97E-15 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 4.51E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.49E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 2.07E-07 | mr1565 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.71E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 4.69E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 6.46E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.03E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 3.80E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 5.34E-22 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 2.12E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 3.69E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.19E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.72E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | 3.69E-06 | NA | mr1922 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 2.57E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.37E-07 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.42E-21 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 8.95E-08 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.07E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.20E-09 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 2.45E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 2.57E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 6.76E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 5.03E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.67E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 5.25E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908568026 | NA | 1.33E-21 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |