\
| Variant ID: vg0908554120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8554120 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGACGAAGGTTGGTCCCTATCTTCTTGGTCATCCTACGTCTCGACTGGTCGTATGTCTCCAATAGCCTTAGTACATATAGCTTGACTTGGATCCACATC[A/C]
CCTACAACATGTACAACAACTTGCTCTCCTTGGGAGCCATTAGATTCATCAAATGTCACATCCCTAGTGACTTCAACAATACCGGAGGTTTTGTTGAAGA
TCTTCAACAAAACCTCCGGTATTGTTGAAGTCACTAGGGATGTGACATTTGATGAATCTAATGGCTCCCAAGGAGAGCAAGTTGTTGTACATGTTGTAGG[T/G]
GATGTGGATCCAAGTCAAGCTATATGTACTAAGGCTATTGGAGACATACGACCAGTCGAGACGTAGGATGACCAAGAAGATAGGGACCAACCTTCGTCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 4.10% | 3.79% | 22.39% | NA |
| All Indica | 2759 | 50.30% | 6.90% | 5.00% | 37.84% | NA |
| All Japonica | 1512 | 96.80% | 0.10% | 2.65% | 0.40% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.37% | 1.12% | NA |
| Indica I | 595 | 25.90% | 17.30% | 7.23% | 49.58% | NA |
| Indica II | 465 | 69.90% | 1.90% | 2.80% | 25.38% | NA |
| Indica III | 913 | 52.50% | 5.50% | 4.82% | 37.24% | NA |
| Indica Intermediate | 786 | 54.60% | 3.60% | 4.83% | 37.02% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 91.10% | 0.40% | 7.74% | 0.79% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908554120 | A -> DEL | LOC_Os09g14470.1 | N | frameshift_variant | Average:23.45; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0908554120 | A -> C | LOC_Os09g14470.1 | synonymous_variant ; p.Gly756Gly; LOW | synonymous_codon | Average:23.45; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908554120 | 5.31E-06 | 6.14E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908554120 | 2.06E-06 | 6.31E-08 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908554120 | NA | 1.03E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908554120 | 3.48E-10 | 1.29E-15 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908554120 | NA | 1.32E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908554120 | NA | 2.64E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |