Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908536377:

Variant ID: vg0908536377 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8536377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGGGGAAGGATGAGAGCGAAGTGATAGAAAGGTATGTGCGTGGGGAGGGGGGTGGGGATCCCGTCTGAAATAGCTAGAACGGTGTCCAAGTTAGTAG[C/T]
ATTTGCATAAAAAAATAGAGTTAATTTCATTTTGGATCATCTTTTGTTACTGATGTTTTATTTTGAATCACCCTTTAACCAACATTTTTATTTTGGGCCG

Reverse complement sequence

CGGCCCAAAATAAAAATGTTGGTTAAAGGGTGATTCAAAATAAAACATCAGTAACAAAAGATGATCCAAAATGAAATTAACTCTATTTTTTTATGCAAAT[G/A]
CTACTAACTTGGACACCGTTCTAGCTATTTCAGACGGGATCCCCACCCCCCTCCCCACGCACATACCTTTCTATCACTTCGCTCTCATCCTTCCCCCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 2.20% 0.04% 0.00% NA
All Indica  2759 96.30% 3.70% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.70% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908536377 C -> T LOC_Os09g14450.1 upstream_gene_variant ; 808.0bp to feature; MODIFIER silent_mutation Average:60.346; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0908536377 C -> T LOC_Os09g14430.1 downstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:60.346; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0908536377 C -> T LOC_Os09g14430-LOC_Os09g14450 intergenic_region ; MODIFIER silent_mutation Average:60.346; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908536377 NA 8.04E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 9.95E-06 7.52E-07 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 1.11E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 9.13E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 1.37E-06 mr1332 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 2.28E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 3.33E-06 NA mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 3.73E-06 1.44E-06 mr1982 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 2.48E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 3.43E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908536377 NA 1.10E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251