Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908388286:

Variant ID: vg0908388286 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8388286
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAATCTCAGAGCCAACACACCCCCCATAGCCTACGAAGTCGGAGCCTGCAGGAGCCGAATCGCCAAGAGATCTAGTCGAACCAACTCGATTACAATCCC[A/G]
TCGGTTTCATCAAGTTCTATCGTTCCCTTTGTAACCTGTGTTTTCCATCATATAATCCCATATCAACTGGATTAGGGCTATTACCTATGAAGGGGCCTGA

Reverse complement sequence

TCAGGCCCCTTCATAGGTAATAGCCCTAATCCAGTTGATATGGGATTATATGATGGAAAACACAGGTTACAAAGGGAACGATAGAACTTGATGAAACCGA[T/C]
GGGATTGTAATCGAGTTGGTTCGACTAGATCTCTTGGCGATTCGGCTCCTGCAGGCTCCGACTTCGTAGGCTATGGGGGGTGTGTTGGCTCTGAGATTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 0.00% 3.91% 39.48% NA
All Indica  2759 48.90% 0.00% 6.05% 45.05% NA
All Japonica  1512 72.80% 0.00% 0.13% 27.12% NA
Aus  269 34.20% 0.00% 4.09% 61.71% NA
Indica I  595 51.40% 0.00% 5.55% 43.03% NA
Indica II  465 78.50% 0.20% 1.08% 20.22% NA
Indica III  913 27.50% 0.00% 9.75% 62.76% NA
Indica Intermediate  786 54.20% 0.00% 5.09% 40.71% NA
Temperate Japonica  767 96.00% 0.00% 0.00% 4.04% NA
Tropical Japonica  504 44.40% 0.00% 0.00% 55.56% NA
Japonica Intermediate  241 58.10% 0.00% 0.83% 41.08% NA
VI/Aromatic  96 66.70% 0.00% 0.00% 33.33% NA
Intermediate  90 77.80% 0.00% 5.56% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908388286 A -> G LOC_Os09g14170.1 upstream_gene_variant ; 1735.0bp to feature; MODIFIER silent_mutation Average:40.147; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0908388286 A -> G LOC_Os09g14180.1 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:40.147; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0908388286 A -> G LOC_Os09g14160.1 downstream_gene_variant ; 2775.0bp to feature; MODIFIER silent_mutation Average:40.147; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0908388286 A -> G LOC_Os09g14170-LOC_Os09g14180 intergenic_region ; MODIFIER silent_mutation Average:40.147; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0908388286 A -> DEL N N silent_mutation Average:40.147; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908388286 4.58E-06 NA mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908388286 NA 3.69E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251