\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908369264:

Variant ID: vg0908369264 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8369264
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTTGGTAGGTAATAGCCCTAATCCAGTTGGTATGGGATTATATGATGGAAACCACGGATTACAAAGGGAATAACAGAACTCGATGATACCGACGAGAC[T/C]
ATAGTCGAGTTGGTTCGACTAGATCACTCGGCGACTTGGCTCCTGTAGGCTTCGGCTTCGTAGGCTGTGGTGGATGTGTTGGCGGTGAGATTCGATGCCT

Reverse complement sequence

AGGCATCGAATCTCACCGCCAACACATCCACCACAGCCTACGAAGCCGAAGCCTACAGGAGCCAAGTCGCCGAGTGATCTAGTCGAACCAACTCGACTAT[A/G]
GTCTCGTCGGTATCATCGAGTTCTGTTATTCCCTTTGTAATCCGTGGTTTCCATCATATAATCCCATACCAACTGGATTAGGGCTATTACCTACCAAGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 1.30% 0.61% 42.09% NA
All Indica  2759 48.80% 1.30% 0.62% 49.26% NA
All Japonica  1512 72.50% 0.10% 0.40% 26.98% NA
Aus  269 27.10% 7.80% 1.49% 63.57% NA
Indica I  595 52.80% 0.00% 0.84% 46.39% NA
Indica II  465 72.90% 6.00% 0.43% 20.65% NA
Indica III  913 30.00% 0.30% 0.55% 69.11% NA
Indica Intermediate  786 53.30% 0.80% 0.64% 45.29% NA
Temperate Japonica  767 95.80% 0.00% 0.13% 4.04% NA
Tropical Japonica  504 44.20% 0.40% 0.99% 54.37% NA
Japonica Intermediate  241 57.30% 0.00% 0.00% 42.74% NA
VI/Aromatic  96 66.70% 0.00% 1.04% 32.29% NA
Intermediate  90 75.60% 1.10% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908369264 T -> DEL N N silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0908369264 T -> C LOC_Os09g14130.1 upstream_gene_variant ; 2923.0bp to feature; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0908369264 T -> C LOC_Os09g14120.1 intron_variant ; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908369264 NA 7.77E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908369264 NA 1.82E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908369264 NA 4.68E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908369264 3.72E-07 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908369264 NA 1.03E-10 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251