\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908324423:

Variant ID: vg0908324423 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8324423
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTAAATTTGGTACCTCTTGGTATCTAGGTACTATGAGGTGCCAAATTTTACACTAAATTTTTGTACCTCATGGTACCTCCTCAAGGACCATAAAATT[C/G]
CTCATGTATTTAAGATAATAGTAGCTCCAGCTACTCTACTCTCCATACGATGGTGGACGCCTTGATGCAGGATGAGCACAATTTTTGCCACAATACTACG

Reverse complement sequence

CGTAGTATTGTGGCAAAAATTGTGCTCATCCTGCATCAAGGCGTCCACCATCGTATGGAGAGTAGAGTAGCTGGAGCTACTATTATCTTAAATACATGAG[G/C]
AATTTTATGGTCCTTGAGGAGGTACCATGAGGTACAAAAATTTAGTGTAAAATTTGGCACCTCATAGTACCTAGATACCAAGAGGTACCAAATTTACAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 10.60% 11.68% 43.99% NA
All Indica  2759 37.50% 1.00% 9.82% 51.61% NA
All Japonica  1512 25.70% 30.00% 16.14% 28.11% NA
Aus  269 26.80% 0.00% 7.81% 65.43% NA
Indica I  595 29.20% 2.20% 19.33% 49.24% NA
Indica II  465 67.30% 0.60% 9.89% 22.15% NA
Indica III  913 26.20% 0.00% 0.99% 72.84% NA
Indica Intermediate  786 39.40% 1.50% 12.85% 46.18% NA
Temperate Japonica  767 26.30% 54.00% 15.65% 4.04% NA
Tropical Japonica  504 26.60% 1.20% 13.69% 58.53% NA
Japonica Intermediate  241 22.00% 14.10% 22.82% 41.08% NA
VI/Aromatic  96 59.40% 1.00% 8.33% 31.25% NA
Intermediate  90 46.70% 17.80% 8.89% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908324423 C -> G LOC_Os09g14060-LOC_Os09g14070 intergenic_region ; MODIFIER silent_mutation Average:31.687; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0908324423 C -> DEL N N silent_mutation Average:31.687; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908324423 NA 2.25E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908324423 NA 1.04E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908324423 NA 3.96E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908324423 NA 1.39E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 2.53E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 9.02E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 2.27E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 6.14E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 1.69E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 7.54E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 6.06E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 7.02E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 8.70E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 8.78E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 1.21E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 5.97E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 4.62E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 5.57E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 5.98E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 3.88E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 1.13E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 4.33E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 7.81E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 2.12E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 5.82E-07 1.84E-11 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 2.39E-06 1.25E-08 mr1748_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 9.74E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 1.67E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 4.12E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908324423 NA 3.87E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251