\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908281367:

Variant ID: vg0908281367 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8281367
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTAATGGATTTTTATTACGTAGAATGATTTATGATGATATAATACATATTGTCAATTTTTTTTACTGTTTTATTCAGATGCAGTTACTATGCAAAGG[G/A]
TAGGATGGCGGTATCTATGACGTATTTAAATTTTTACAAAGTAACATATATGTAATATAGATCTTGACTTATTTATTTAATTATAATATAGTAACAATTA

Reverse complement sequence

TAATTGTTACTATATTATAATTAAATAAATAAGTCAAGATCTATATTACATATATGTTACTTTGTAAAAATTTAAATACGTCATAGATACCGCCATCCTA[C/T]
CCTTTGCATAGTAACTGCATCTGAATAAAACAGTAAAAAAAATTGACAATATGTATTATATCATCATAAATCATTCTACGTAATAAAAATCCATTAATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.40% 6.70% 1.76% 46.13% NA
All Indica  2759 38.10% 10.50% 1.92% 49.51% NA
All Japonica  1512 62.20% 0.20% 1.65% 35.98% NA
Aus  269 13.00% 7.80% 0.74% 78.44% NA
Indica I  595 37.50% 10.60% 3.19% 48.74% NA
Indica II  465 64.70% 9.70% 2.15% 23.44% NA
Indica III  913 23.20% 10.60% 0.66% 65.50% NA
Indica Intermediate  786 40.10% 10.70% 2.29% 46.95% NA
Temperate Japonica  767 91.00% 0.10% 0.00% 8.87% NA
Tropical Japonica  504 28.40% 0.40% 1.98% 69.25% NA
Japonica Intermediate  241 41.10% 0.00% 6.22% 52.70% NA
VI/Aromatic  96 63.50% 2.10% 2.08% 32.29% NA
Intermediate  90 64.40% 3.30% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908281367 G -> DEL N N silent_mutation Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 N N N N
vg0908281367 G -> A LOC_Os09g14019.1 downstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 N N N N
vg0908281367 G -> A LOC_Os09g14010-LOC_Os09g14019 intergenic_region ; MODIFIER silent_mutation Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908281367 NA 2.70E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 5.40E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 9.22E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 6.30E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 2.04E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 9.36E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 4.77E-08 mr1984 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367 NA 3.50E-07 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251