| Variant ID: vg0908281367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8281367 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 58. )
CAATTAATGGATTTTTATTACGTAGAATGATTTATGATGATATAATACATATTGTCAATTTTTTTTACTGTTTTATTCAGATGCAGTTACTATGCAAAGG[G/A]
TAGGATGGCGGTATCTATGACGTATTTAAATTTTTACAAAGTAACATATATGTAATATAGATCTTGACTTATTTATTTAATTATAATATAGTAACAATTA
TAATTGTTACTATATTATAATTAAATAAATAAGTCAAGATCTATATTACATATATGTTACTTTGTAAAAATTTAAATACGTCATAGATACCGCCATCCTA[C/T]
CCTTTGCATAGTAACTGCATCTGAATAAAACAGTAAAAAAAATTGACAATATGTATTATATCATCATAAATCATTCTACGTAATAAAAATCCATTAATTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.40% | 6.70% | 1.76% | 46.13% | NA |
| All Indica | 2759 | 38.10% | 10.50% | 1.92% | 49.51% | NA |
| All Japonica | 1512 | 62.20% | 0.20% | 1.65% | 35.98% | NA |
| Aus | 269 | 13.00% | 7.80% | 0.74% | 78.44% | NA |
| Indica I | 595 | 37.50% | 10.60% | 3.19% | 48.74% | NA |
| Indica II | 465 | 64.70% | 9.70% | 2.15% | 23.44% | NA |
| Indica III | 913 | 23.20% | 10.60% | 0.66% | 65.50% | NA |
| Indica Intermediate | 786 | 40.10% | 10.70% | 2.29% | 46.95% | NA |
| Temperate Japonica | 767 | 91.00% | 0.10% | 0.00% | 8.87% | NA |
| Tropical Japonica | 504 | 28.40% | 0.40% | 1.98% | 69.25% | NA |
| Japonica Intermediate | 241 | 41.10% | 0.00% | 6.22% | 52.70% | NA |
| VI/Aromatic | 96 | 63.50% | 2.10% | 2.08% | 32.29% | NA |
| Intermediate | 90 | 64.40% | 3.30% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908281367 | G -> DEL | N | N | silent_mutation | Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg0908281367 | G -> A | LOC_Os09g14019.1 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg0908281367 | G -> A | LOC_Os09g14010-LOC_Os09g14019 | intergenic_region ; MODIFIER | silent_mutation | Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908281367 | NA | 2.70E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 5.40E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 9.22E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 6.30E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 2.04E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 9.36E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 4.77E-08 | mr1984 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908281367 | NA | 3.50E-07 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |