Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908281367:

Variant ID: vg0908281367 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8281367
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTAATGGATTTTTATTACGTAGAATGATTTATGATGATATAATACATATTGTCAATTTTTTTTACTGTTTTATTCAGATGCAGTTACTATGCAAAGG[G/A]
TAGGATGGCGGTATCTATGACGTATTTAAATTTTTACAAAGTAACATATATGTAATATAGATCTTGACTTATTTATTTAATTATAATATAGTAACAATTA

Reverse complement sequence

TAATTGTTACTATATTATAATTAAATAAATAAGTCAAGATCTATATTACATATATGTTACTTTGTAAAAATTTAAATACGTCATAGATACCGCCATCCTA[C/T]
CCTTTGCATAGTAACTGCATCTGAATAAAACAGTAAAAAAAATTGACAATATGTATTATATCATCATAAATCATTCTACGTAATAAAAATCCATTAATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.40%	6.70%	1.76%	46.13%	NA
All Indica	2759	38.10%	10.50%	1.92%	49.51%	NA
All Japonica	1512	62.20%	0.20%	1.65%	35.98%	NA
Aus	269	13.00%	7.80%	0.74%	78.44%	NA
Indica I	595	37.50%	10.60%	3.19%	48.74%	NA
Indica II	465	64.70%	9.70%	2.15%	23.44%	NA
Indica III	913	23.20%	10.60%	0.66%	65.50%	NA
Indica Intermediate	786	40.10%	10.70%	2.29%	46.95%	NA
Temperate Japonica	767	91.00%	0.10%	0.00%	8.87%	NA
Tropical Japonica	504	28.40%	0.40%	1.98%	69.25%	NA
Japonica Intermediate	241	41.10%	0.00%	6.22%	52.70%	NA
VI/Aromatic	96	63.50%	2.10%	2.08%	32.29%	NA
Intermediate	90	64.40%	3.30%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908281367	G -> DEL	N	N	silent_mutation	Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0908281367	G -> A	LOC_Os09g14019.1	downstream_gene_variant ; 1324.0bp to feature; MODIFIER	silent_mutation	Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0908281367	G -> A	LOC_Os09g14010-LOC_Os09g14019	intergenic_region ; MODIFIER	silent_mutation	Average:24.586; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908281367	NA	2.70E-07	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	5.40E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	9.22E-08	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	6.30E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	2.04E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	9.36E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	4.77E-08	mr1984	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908281367	NA	3.50E-07	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251