Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908235569:

Variant ID: vg0908235569 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8235569
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGGTTGTCGGAAGTCAAATTTCTGGGTCACGTTATTACTACTCAAGGTGTGGCAGTGGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACCCCACC[T/G,A]
AAGACAGTTTCTCAGATCCGGAGTTTTTTTGGACTTGCGGGTTATTATCGTCGGTTCATTGAAAATTTCTCCAAGATTGCCAGGCCCATGACACAGTTGC

Reverse complement sequence

GCAACTGTGTCATGGGCCTGGCAATCTTGGAGAAATTTTCAATGAACCGACGATAATAACCCGCAAGTCCAAAAAAACTCCGGATCTGAGAAACTGTCTT[A/C,T]
GGTGGGGTCCACTTGGTAACTGACTCCACATTCGATGGATCCACTGCCACACCTTGAGTAGTAATAACGTGACCCAGAAATTTGACTTCCGACAACCAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	32.20%	12.12%	8.63%	A: 1.18%
All Indica	2759	38.70%	36.70%	16.46%	6.23%	A: 1.88%
All Japonica	1512	60.70%	20.90%	3.64%	14.62%	A: 0.13%
Aus	269	23.00%	57.20%	17.47%	2.23%	NA
Indica I	595	40.00%	32.90%	20.34%	4.20%	A: 2.52%
Indica II	465	67.30%	11.20%	13.98%	6.67%	A: 0.86%
Indica III	913	22.00%	52.90%	15.44%	8.21%	A: 1.42%
Indica Intermediate	786	40.20%	35.90%	16.16%	5.22%	A: 2.54%
Temperate Japonica	767	90.10%	1.80%	1.96%	6.00%	A: 0.13%
Tropical Japonica	504	25.80%	49.40%	3.57%	21.23%	NA
Japonica Intermediate	241	40.20%	22.00%	9.13%	28.22%	A: 0.41%
VI/Aromatic	96	66.70%	18.80%	11.46%	3.12%	NA
Intermediate	90	63.30%	21.10%	6.67%	6.67%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908235569	T -> G	LOC_Os09g13980.1	synonymous_variant ; p.Pro323Pro; LOW	synonymous_codon	Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0908235569	T -> DEL	LOC_Os09g13980.1	N	frameshift_variant	Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0908235569	T -> A	LOC_Os09g13980.1	synonymous_variant ; p.Pro323Pro; LOW	synonymous_codon	Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908235569	NA	1.38E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	3.40E-07	NA	mr1109	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	5.86E-13	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	3.22E-08	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	6.16E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	2.66E-08	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	4.84E-08	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	4.93E-07	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	6.69E-08	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.79E-08	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	6.47E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	2.81E-07	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	7.14E-06	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	4.72E-14	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.16E-11	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	4.02E-09	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	2.95E-10	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	8.17E-09	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	6.59E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.08E-09	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.02E-11	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	8.51E-09	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.20E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.34E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569	NA	1.31E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251