\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908235569:

Variant ID: vg0908235569 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8235569
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGGTTGTCGGAAGTCAAATTTCTGGGTCACGTTATTACTACTCAAGGTGTGGCAGTGGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACCCCACC[T/G,A]
AAGACAGTTTCTCAGATCCGGAGTTTTTTTGGACTTGCGGGTTATTATCGTCGGTTCATTGAAAATTTCTCCAAGATTGCCAGGCCCATGACACAGTTGC

Reverse complement sequence

GCAACTGTGTCATGGGCCTGGCAATCTTGGAGAAATTTTCAATGAACCGACGATAATAACCCGCAAGTCCAAAAAAACTCCGGATCTGAGAAACTGTCTT[A/C,T]
GGTGGGGTCCACTTGGTAACTGACTCCACATTCGATGGATCCACTGCCACACCTTGAGTAGTAATAACGTGACCCAGAAATTTGACTTCCGACAACCAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 32.20% 12.12% 8.63% A: 1.18%
All Indica  2759 38.70% 36.70% 16.46% 6.23% A: 1.88%
All Japonica  1512 60.70% 20.90% 3.64% 14.62% A: 0.13%
Aus  269 23.00% 57.20% 17.47% 2.23% NA
Indica I  595 40.00% 32.90% 20.34% 4.20% A: 2.52%
Indica II  465 67.30% 11.20% 13.98% 6.67% A: 0.86%
Indica III  913 22.00% 52.90% 15.44% 8.21% A: 1.42%
Indica Intermediate  786 40.20% 35.90% 16.16% 5.22% A: 2.54%
Temperate Japonica  767 90.10% 1.80% 1.96% 6.00% A: 0.13%
Tropical Japonica  504 25.80% 49.40% 3.57% 21.23% NA
Japonica Intermediate  241 40.20% 22.00% 9.13% 28.22% A: 0.41%
VI/Aromatic  96 66.70% 18.80% 11.46% 3.12% NA
Intermediate  90 63.30% 21.10% 6.67% 6.67% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908235569 T -> G LOC_Os09g13980.1 synonymous_variant ; p.Pro323Pro; LOW synonymous_codon Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0908235569 T -> DEL LOC_Os09g13980.1 N frameshift_variant Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0908235569 T -> A LOC_Os09g13980.1 synonymous_variant ; p.Pro323Pro; LOW synonymous_codon Average:25.15; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908235569 NA 1.38E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 3.40E-07 NA mr1109 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 5.86E-13 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 3.22E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 6.16E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 2.66E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 4.84E-08 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 4.93E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 6.69E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.79E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 6.47E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 2.81E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 7.14E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 4.72E-14 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.16E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 4.02E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 2.95E-10 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 8.17E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 6.59E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.08E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.02E-11 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 8.51E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.20E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.34E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235569 NA 1.31E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251