\
| Variant ID: vg0908235271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8235271 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.02, others allele: 0.00, population size: 59. )
CGATCAGGCTATCATCAGTTGAGAATTCAGGAGGAGGATATTCCCAAGACAGCCTTCACCACTCGGTATGGGTTGTTTGAGTGCACGGTTATGTCATTTG[G/A]
ACTCACCAATGCACCGGTTTTCTTCATGAACTTGATGAACAAAGTGTTTATGGAATTTCTGGACAAGTTTGTCGTGGTGTTCATTGACGACATACTTATT
AATAAGTATGTCGTCAATGAACACCACGACAAACTTGTCCAGAAATTCCATAAACACTTTGTTCATCAAGTTCATGAAGAAAACCGGTGCATTGGTGAGT[C/T]
CAAATGACATAACCGTGCACTCAAACAACCCATACCGAGTGGTGAAGGCTGTCTTGGGAATATCCTCCTCCTGAATTCTCAACTGATGATAGCCTGATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 0.90% | 5.04% | 1.59% | NA |
| All Indica | 2759 | 93.30% | 1.60% | 5.18% | 0.00% | NA |
| All Japonica | 1512 | 88.90% | 0.00% | 6.15% | 4.96% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 3.00% | 7.73% | 0.00% | NA |
| Indica II | 465 | 94.60% | 1.10% | 4.30% | 0.00% | NA |
| Indica III | 913 | 96.90% | 0.10% | 2.96% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 2.40% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 1.43% | 2.22% | NA |
| Tropical Japonica | 504 | 84.70% | 0.00% | 12.30% | 2.98% | NA |
| Japonica Intermediate | 241 | 73.90% | 0.00% | 8.30% | 17.84% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908235271 | G -> DEL | LOC_Os09g13980.1 | N | frameshift_variant | Average:23.874; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0908235271 | G -> A | LOC_Os09g13980.1 | missense_variant ; p.Gly224Glu; MODERATE | nonsynonymous_codon ; G224E | Average:23.874; most accessible tissue: Minghui63 young leaf, score: 61.007 | benign |
0.908 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908235271 | NA | 2.46E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 8.91E-13 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 9.91E-10 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | 3.77E-07 | NA | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | 6.55E-07 | 6.31E-11 | mr1251 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 6.29E-07 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 7.30E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 1.52E-08 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 3.51E-09 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 9.69E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 1.59E-08 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 1.18E-06 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 2.65E-12 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 2.45E-10 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 2.36E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 2.61E-08 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 5.36E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 1.18E-09 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908235271 | NA | 2.15E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |