\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908235149:

Variant ID: vg0908235149 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8235149
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATGTGCGTTGATTATCGCGCCCTTAATGAGGTCACAATCAAGAACAAATATCCGTTGCCAAGAATTGATGACCTGTTTGATCAGCTAAAAGGAGCTAA[G/A]
GTGTTTTCCAAGATAGACCTGCGATCAGGCTATCATCAGTTGAGAATTCAGGAGGAGGATATTCCCAAGACAGCCTTCACCACTCGGTATGGGTTGTTTG

Reverse complement sequence

CAAACAACCCATACCGAGTGGTGAAGGCTGTCTTGGGAATATCCTCCTCCTGAATTCTCAACTGATGATAGCCTGATCGCAGGTCTATCTTGGAAAACAC[C/T]
TTAGCTCCTTTTAGCTGATCAAACAGGTCATCAATTCTTGGCAACGGATATTTGTTCTTGATTGTGACCTCATTAAGGGCGCGATAATCAACGCACATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 19.10% 26.62% 2.73% NA
All Indica  2759 37.90% 30.10% 27.47% 4.53% NA
All Japonica  1512 78.80% 1.30% 19.64% 0.26% NA
Aus  269 25.30% 15.20% 59.48% 0.00% NA
Indica I  595 40.30% 28.10% 30.76% 0.84% NA
Indica II  465 62.20% 15.30% 11.18% 11.40% NA
Indica III  913 21.80% 41.60% 33.30% 3.29% NA
Indica Intermediate  786 40.50% 27.00% 27.86% 4.71% NA
Temperate Japonica  767 94.40% 0.70% 4.82% 0.13% NA
Tropical Japonica  504 67.10% 1.00% 31.94% 0.00% NA
Japonica Intermediate  241 53.90% 3.70% 41.08% 1.24% NA
VI/Aromatic  96 72.90% 4.20% 22.92% 0.00% NA
Intermediate  90 67.80% 8.90% 23.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908235149 G -> DEL LOC_Os09g13980.1 N frameshift_variant Average:25.264; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg0908235149 G -> A LOC_Os09g13980.1 synonymous_variant ; p.Lys183Lys; LOW synonymous_codon Average:25.264; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908235149 NA 2.40E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 8.78E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 5.00E-11 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 2.36E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 3.50E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 8.00E-06 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 6.19E-09 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.23E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.39E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.84E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 7.43E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.35E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 1.46E-06 NA mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 2.42E-12 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.19E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 2.32E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 9.67E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.02E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 6.38E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.13E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908235149 NA 1.05E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251