Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908132614:

Variant ID: vg0908132614 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8132614
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGACGAAGCAACGATCATATATCATTTTATGTAATCATGTGGCCAGCAATATACTAAATTAAGTTGCCAAGCCTCCGGCGGCCGGATCTTTCGCCGGCG[G/A,C]
CGGCGGCGGCGGCATCGGCGTCGCTGGAGGCTGTTGATCTACTACCTTAGAGGCCGGACCACTTTTTTCCGGCGACGGCAACAGCGGCGCCTTCTTGCAG

Reverse complement sequence

CTGCAAGAAGGCGCCGCTGTTGCCGTCGCCGGAAAAAAGTGGTCCGGCCTCTAAGGTAGTAGATCAACAGCCTCCAGCGACGCCGATGCCGCCGCCGCCG[C/T,G]
CGCCGGCGAAAGATCCGGCCGCCGGAGGCTTGGCAACTTAATTTAGTATATTGCTGGCCACATGATTACATAAAATGATATATGATCGTTGCTTCGTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	10.30%	0.06%	0.00%	C: 0.02%
All Indica	2759	91.10%	8.80%	0.11%	0.00%	C: 0.04%
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	84.70%	15.10%	0.11%	0.00%	C: 0.11%
Indica Intermediate	786	89.80%	9.90%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	93.70%	6.30%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908132614	G -> C	LOC_Os09g13850.1	upstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:58.301; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0908132614	G -> C	LOC_Os09g13830-LOC_Os09g13850	intergenic_region ; MODIFIER	silent_mutation	Average:58.301; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0908132614	G -> A	LOC_Os09g13850.1	upstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:58.301; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0908132614	G -> A	LOC_Os09g13830-LOC_Os09g13850	intergenic_region ; MODIFIER	silent_mutation	Average:58.301; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908132614	NA	4.89E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	5.07E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	9.80E-08	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	5.00E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	2.42E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	2.59E-11	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	4.53E-07	4.53E-07	mr1499	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	5.87E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908132614	NA	2.68E-07	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251