\
| Variant ID: vg0907980770 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7980770 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 101. )
TTACGGTGTAACTTACAGCTGGTAATTTGTACAGTGTAACAACGATTTACTGTTTTTTAAAACGTGATGTAATAAATATAGCTGAAAAAAGAATACATCA[C/T]
GTTAATAGCTAGTTGTATGTATTATTTATGCATAATTTGGAGGCAAATTAAAAGTTCCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTCGTAACCCCCC
GGGGGGTTACGAACCGGGACTACAAAGGGTTTCTCCACCAGTGGAACTTTTAATTTGCCTCCAAATTATGCATAAATAATACATACAACTAGCTATTAAC[G/A]
TGATGTATTCTTTTTTCAGCTATATTTATTACATCACGTTTTAAAAAACAGTAAATCGTTGTTACACTGTACAAATTACCAGCTGTAAGTTACACCGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 66.30% | 33.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 51.70% | 48.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.90% | 17.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 57.50% | 42.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 37.30% | 62.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907980770 | C -> T | LOC_Os09g13660.1 | downstream_gene_variant ; 610.0bp to feature; MODIFIER | silent_mutation | Average:28.866; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0907980770 | C -> T | LOC_Os09g13650-LOC_Os09g13660 | intergenic_region ; MODIFIER | silent_mutation | Average:28.866; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907980770 | NA | 1.51E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 2.21E-10 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 6.87E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 9.36E-09 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 8.70E-11 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 2.35E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 2.22E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 2.69E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 1.38E-08 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 1.10E-08 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 9.56E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 4.67E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | 9.21E-07 | 9.20E-07 | mr1548_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 1.95E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 8.06E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 9.25E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 4.31E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907980770 | NA | 1.36E-06 | mr1910_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |