\
| Variant ID: vg0907977858 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7977858 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )
AATATATATTTTTTTCATAAAATAGACGGTAGATTTTAATATACTACTAATGTGATAGGAATGTCCCTCAAATTTAAATAAAAATCCCTTTGTCCTGGTC[A/G]
ATTTGTGGTAGAGAATAGACGATTTGTATATGAAGTTAGTAATAAGTTCATCTCAAATTTTAATGGACTACATACAATATTATGTTGTTTTTCAAATGAG
CTCATTTGAAAAACAACATAATATTGTATGTAGTCCATTAAAATTTGAGATGAACTTATTACTAACTTCATATACAAATCGTCTATTCTCTACCACAAAT[T/C]
GACCAGGACAAAGGGATTTTTATTTAAATTTGAGGGACATTCCTATCACATTAGTAGTATATTAAAATCTACCGTCTATTTTATGAAAAAAATATATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.50% | 19.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 93.60% | 6.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 52.10% | 47.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.60% | 6.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.70% | 10.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.70% | 62.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 58.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907977858 | A -> G | LOC_Os09g13660.1 | downstream_gene_variant ; 3522.0bp to feature; MODIFIER | silent_mutation | Average:27.563; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0907977858 | A -> G | LOC_Os09g13650-LOC_Os09g13660 | intergenic_region ; MODIFIER | silent_mutation | Average:27.563; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907977858 | NA | 9.59E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 2.45E-09 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 7.30E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 2.88E-11 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 6.85E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 3.52E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 1.69E-08 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 1.79E-08 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 2.31E-08 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 8.29E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | 2.79E-07 | 2.79E-07 | mr1548_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 2.24E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 2.16E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907977858 | NA | 7.28E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |