\
| Variant ID: vg0907974545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7974545 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )
GCATTTCCCACATTCATATTGATGTTAATGAATCTAGACATATATATCTATTTAGATTCATTAACATCAACATAAATGTGTGAAATGCTAGAATGATTTA[T/C]
ATTGTGAAACGGAGGAAGTACTATATATCTTATACTTGAATATACATATATAGGATGTGTTTATGTGTGTGATGACTGCCAGAGCATGCATGCATGTAAC
GTTACATGCATGCATGCTCTGGCAGTCATCACACACATAAACACATCCTATATATGTATATTCAAGTATAAGATATATAGTACTTCCTCCGTTTCACAAT[A/G]
TAAATCATTCTAGCATTTCACACATTTATGTTGATGTTAATGAATCTAAATAGATATATATGTCTAGATTCATTAACATCAATATGAATGTGGGAAATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.30% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 52.60% | 46.40% | 0.99% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 38.30% | 59.80% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 57.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907974545 | T -> C | LOC_Os09g13650-LOC_Os09g13660 | intergenic_region ; MODIFIER | silent_mutation | Average:57.314; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907974545 | NA | 1.71E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 2.21E-10 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 6.87E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | 6.95E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 5.05E-12 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 8.70E-11 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 2.35E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 1.38E-08 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 4.07E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 1.10E-08 | mr1379_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 9.56E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | 9.21E-07 | 9.20E-07 | mr1548_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 1.95E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 8.06E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907974545 | NA | 9.25E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |