Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907970534:

Variant ID: vg0907970534 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7970534
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CTTACATGCATGCAGCATGTAGAGAGATAGGGAGGACGATCACTTTTGCCGCGTCTAGGGTTTCCTTCTTACCGTGCGGTTACCGCTAGATCGTATGGTT[C/A]
ATGATGAGGGTATAGTAATTTGACCAAGTTCAAGAGAGTTTTAAAGTTTTGGTCGGTAACCAATTGAGCTTATCATGGGAGAGGATAATATTATCCTCTC

Reverse complement sequence

GAGAGGATAATATTATCCTCTCCCATGATAAGCTCAATTGGTTACCGACCAAAACTTTAAAACTCTCTTGAACTTGGTCAAATTACTATACCCTCATCAT[G/T]
AACCATACGATCTAGCGGTAACCGCACGGTAAGAAGGAAACCCTAGACGCGGCAAAAGTGATCGTCCTCCCTATCTCTCTACATGCTGCATGCATGTAAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.50%	0.32%	0.00%	NA
All Indica	2759	90.20%	9.80%	0.04%	0.00%	NA
All Japonica	1512	42.00%	57.10%	0.93%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	81.30%	18.70%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.70%	0.00%	0.00%	NA
Temperate Japonica	767	10.30%	88.10%	1.56%	0.00%	NA
Tropical Japonica	504	82.30%	17.50%	0.20%	0.00%	NA
Japonica Intermediate	241	58.50%	41.10%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907970534	C -> A	LOC_Os09g13650.1	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:67.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg0907970534	C -> A	LOC_Os09g13650.2	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:67.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg0907970534	C -> A	LOC_Os09g13650.3	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:67.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg0907970534	C -> A	LOC_Os09g13650-LOC_Os09g13660	intergenic_region ; MODIFIER	silent_mutation	Average:67.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907970534	NA	1.06E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	2.06E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	9.42E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	1.11E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	1.06E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	5.99E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	4.75E-15	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	NA	2.77E-12	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907970534	4.16E-06	4.32E-07	mr1957_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251