\
| Variant ID: vg0907965825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7965825 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )
TATATGCAACTAATCCTTTAATTAATTAAAAACGAAGAGTACAGGCGGATTTCCTTTGATGCTCACACGTGAGATATATACATATAACTACAAAAAGAAT[A/G]
TCTAAACGATTCTTAATTTCCTCTCTGAACGATGCTTGAAATTTTGTCTCAAAACATTAAAAAAATAATTTACCTAAAAAATGGTAAAATTTTGTAGTTC
GAACTACAAAATTTTACCATTTTTTAGGTAAATTATTTTTTTAATGTTTTGAGACAAAATTTCAAGCATCGTTCAGAGAGGAAATTAAGAATCGTTTAGA[T/C]
ATTCTTTTTGTAGTTATATGTATATATCTCACGTGTGAGCATCAAAGGAAATCCGCCTGTACTCTTCGTTTTTAATTAATTAAAGGATTAGTTGCATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 20.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 48.40% | 51.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.80% | 10.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 36.40% | 63.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 76.80% | 23.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.40% | 72.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907965825 | A -> G | LOC_Os09g13650.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.97; most accessible tissue: Callus, score: 58.369 | N | N | N | N |
| vg0907965825 | A -> G | LOC_Os09g13650.2 | intron_variant ; MODIFIER | silent_mutation | Average:30.97; most accessible tissue: Callus, score: 58.369 | N | N | N | N |
| vg0907965825 | A -> G | LOC_Os09g13650.3 | intron_variant ; MODIFIER | silent_mutation | Average:30.97; most accessible tissue: Callus, score: 58.369 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907965825 | 2.26E-06 | 6.62E-13 | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | 6.62E-06 | 1.05E-13 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 9.20E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 3.28E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 3.22E-14 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 7.45E-11 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 2.87E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 6.08E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 2.34E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 1.21E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 2.55E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 4.09E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907965825 | NA | 4.11E-10 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |